fix quoting of cutadapt command-line arguments

snakemake-workflows · Aug 28, 2023 · 0fcd88b · 0fcd88b
1 parent 71b8743
commit 0fcd88b
Show file tree

Hide file tree

Showing 2 changed files with 2 additions and 2 deletions.
diff --git a/.test/3-prime-config/config/config.yaml b/.test/3-prime-config/config/config.yaml
@@ -123,7 +123,7 @@ params:
     # This setup is for Lexogen QuantSeq FWD data, based on (but simplfied):
     # https://faqs.lexogen.com/faq/what-is-the-adapter-sequence-i-need-to-use-for-t-1
     # For more details, see the QuantSeq section in the `config/README.md` file.
-    adapters: "-a r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=7;max_error_rate=0.005"
+    adapters: "-a 'r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=7;max_error_rate=0.005'"
     extra: "--minimum-length 33 --nextseq-trim=20 --poly-a"
   # reasoning behind parameters:
   #   For reads that are produced by 3’-end sequencing, depending on the protocol, it might be recommended to remove some leading bases (e.g. see https://www.nature.com/articles/s41598-019-55434-x#Sec10)

diff --git a/config/README.md b/config/README.md
@@ -56,7 +56,7 @@ For Lexogen 3' QuantSeq data analysis, please set `experiment: 3-prime-rna-seq:
 For more information information on Lexogen QuantSeq 3' sequencing, see: https://www.lexogen.com/quantseq-3mrna-sequencing/
 In addition, for Lexogen 3' FWD QuantSeq data, we recommend setting the `params: cutadapt-se:` with:
 ```
-    adapters: "-a r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=7;max_error_rate=0.005"
+    adapters: "-a 'r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=7;max_error_rate=0.005'"
     extra: "--minimum-length 33 --nextseq-trim=20 --poly-a"
 ```
 This is an adaptation of the [Lexogen read preprocessing recommendations for 3' FWD QuantSeq data](https://faqs.lexogen.com/faq/what-is-the-adapter-sequence-i-need-to-use-for-t-1).