-
-
Notifications
You must be signed in to change notification settings - Fork 30
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Rename nucleotide-count files (#241)
- Loading branch information
Showing
7 changed files
with
36 additions
and
42 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Empty file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
(defmodule nucleotide-count | ||
(export (counts 1))) | ||
|
||
; Please implement the counts function |
This file was deleted.
Oops, something went wrong.
25 changes: 25 additions & 0 deletions
25
exercises/practice/nucleotide-count/test/nucleotide-count-tests.lfe
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,25 @@ | ||
(defmodule nucleotide-count-tests | ||
(behaviour ltest-unit) | ||
(export all)) | ||
|
||
(include-lib "ltest/include/ltest-macros.lfe") | ||
|
||
(deftest empty-strand | ||
(is-equal `(#("A" 0) #("C" 0) #("G" 0) #("T" 0)) | ||
(nucleotide-count:counts ""))) | ||
|
||
(deftest can-count-one-nucleotide-in-single-character-input | ||
(is-equal `(#("A" 0) #("C" 0) #("G" 1) #("T" 0)) | ||
(nucleotide-count:counts "G"))) | ||
|
||
(deftest strand-with-repeated-nucleotide | ||
(is-equal `(#("A" 0) #("C" 0) #("G" 7) #("T" 0)) | ||
(nucleotide-count:counts "GGGGGGG"))) | ||
|
||
(deftest strand-with-multiple-nucleotides | ||
(is-equal `(#("A" 20) #("C" 12) #("G" 17) #("T" 21)) | ||
(nucleotide-count:counts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"))) | ||
|
||
(deftest strand-with-invalid-nucleotides | ||
(is-error (nucleotide-count:counts "AGXXACT"))) | ||
|