Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

-fixes a bug in the liftover logic whereby when the alleles couldn't … #1956

Merged
merged 3 commits into from
Apr 11, 2024
Merged

-fixes a bug in the liftover logic whereby when the alleles couldn't … #1956

Show file tree
Hide file tree
Changes from 2 commits
Commits
Show all changes
3 commits
Select commit Hold shift + click to select a range
b713345
-fixes a bug in the liftover logic whereby when the alleles couldn't …
yfarjoun Apr 5, 2024
be175a5
- & -> | (oops)
yfarjoun Apr 5, 2024
2bbe0d0
responding to review comments
yfarjoun Apr 10, 2024
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
37 changes: 25 additions & 12 deletions src/main/java/picard/util/LiftoverUtils.java
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -372,15 +372,15 @@ protected static void leftAlignVariant(final VariantContextBuilder builder, fina

// 1. while changes in alleles do
while (changesInAlleles) {
final int oldStart = theStart;
final int oldEnd = theEnd;

changesInAlleles = false;
// 2. if alleles end with the same nucleotide then
if (alleleBasesMap.values().stream()
.collect(Collectors.groupingBy(a -> a[a.length - 1], Collectors.toSet()))
.size() == 1 && theEnd > 1) {
// 3. truncate rightmost nucleotide of each allele
Copy link
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Can this be turned into a continuation of comment 2? If I understand right, this block just trims the alleles if they end with the same string (e.g. REF = "ACG", ALT="ATG" -> REF = "AC", ALT="AT" ... maybe even put this example in comment?)

alleleBasesMap.replaceAll((a, v) -> truncateBase(alleleBasesMap.get(a), true));
changesInAlleles = true;
theEnd--;
// 4. end if
}
Expand All @@ -390,20 +390,29 @@ protected static void leftAlignVariant(final VariantContextBuilder builder, fina
.map(a -> a.length)
.anyMatch(l -> l == 0)) {
// 6. extend alleles 1 nucleotide to the left
Copy link
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

This comment should also merge with 5. I'm also not sure what it means to have an "empty allele." Can this have an example in comment?



Copy link
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Remove a newline

final byte extraBase;
final boolean extendLeft;
if (theStart > 1) {
extraBase = referenceSequence.getBases()[theStart - 2];
extendLeft = true;
theStart--;
} else {
extraBase = referenceSequence.getBases()[theEnd];
extendLeft = false;
theEnd++;
}

for (final Allele allele : alleleBasesMap.keySet()) {
// the first -1 for zero-base (getBases) versus 1-based (variant position)
Copy link
Contributor

@rickymagner rickymagner Apr 9, 2024 •
edited
Loading

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

These comments should be updated/repositioned/removed

// another -1 to get the base prior to the location of the start of the allele
final byte extraBase = (theStart > 1) ?
referenceSequence.getBases()[theStart - 2] :
referenceSequence.getBases()[theEnd];

alleleBasesMap.put(allele, extendOneBase(alleleBasesMap.get(allele), extraBase));
alleleBasesMap.put(allele, extendOneBase(alleleBasesMap.get(allele), extraBase, extendLeft));
}
changesInAlleles = true;
theStart--;

// 7. end if
}
changesInAlleles = theStart!=oldStart || theEnd != oldEnd;
Copy link
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

This means repeat the above block of truncating matching right bases, and handling whatever empty alleles mean, whenever there's been a change in the variant. Is a while block the best way to handle this? Why not just truncate all matching bases on the right in one go, and then handle this other empty edge case as well?

}

// 8. while leftmost nucleotide of each allele are the same and all alleles have length 2 or more do
Expand Down Expand Up @@ -451,12 +460,16 @@ private static byte[] truncateBase(final byte[] allele, final boolean truncateRi
truncateRightmost ? allele.length - 1 : allele.length);
}

//creates a new byte array with the base added at the beginning
private static byte[] extendOneBase(final byte[] bases, final byte base) {
return extendOneBase(bases, base, true);
}

//creates a new byte array with the base added at the beginning
private static byte[] extendOneBase(final byte[] bases, final byte base, final boolean extendLeft) {
final byte[] newBases = new byte[bases.length + 1];

System.arraycopy(bases, 0, newBases, 1, bases.length);
newBases[0] = base;
System.arraycopy(bases, 0, newBases, extendLeft ? 1 : 0, bases.length);
newBases[extendLeft ? 0 : bases.length] = base;

return newBases;
}
Expand Down
58 changes: 52 additions & 6 deletions src/test/java/picard/util/LiftoverVcfTest.java
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -4,10 +4,7 @@
import htsjdk.samtools.liftover.LiftOver;
import htsjdk.samtools.reference.FastaSequenceFile;
import htsjdk.samtools.reference.ReferenceSequence;
import htsjdk.samtools.util.CloseableIterator;
import htsjdk.samtools.util.CollectionUtil;
import htsjdk.samtools.util.IOUtil;
import htsjdk.samtools.util.Interval;
import htsjdk.samtools.util.*;
import htsjdk.variant.variantcontext.Allele;
import htsjdk.variant.variantcontext.Genotype;
import htsjdk.variant.variantcontext.GenotypeBuilder;
Expand Down Expand Up @@ -59,6 +56,10 @@ public class LiftoverVcfTest extends CommandLineProgramTest {
private static final String refString = "CAAAAAAAAAACGTACGTACTCTCTCTCTACGT";
private static final ReferenceSequence REFERENCE = new ReferenceSequence("chr1", 0, refString.getBytes());

private static final String refStringWithRepeat = "CGTCGTCGT";

private static final ReferenceSequence REFERENCE_WITH_REPEATS = new ReferenceSequence("chr1", 0, refStringWithRepeat.getBytes());

public String getCommandLineProgramName() {
return LiftoverVcf.class.getSimpleName();
}
Expand Down Expand Up @@ -174,8 +175,8 @@ public void testChangingTagArguments() {
@Test
public void testReverseComplementFailureDoesNotErrorOut() {
final VariantContextBuilder builder = new VariantContextBuilder().source("test").loc("chr1", 1, 4);
final Allele originalRef = Allele.create("CCCC", true);
final Allele originalAlt = Allele.create("C", false);
final Allele originalRef = Allele.create("TCAT", true);
final Allele originalAlt = Allele.create("T", false);
builder.alleles(Arrays.asList(originalRef, originalAlt));

final Interval interval = new Interval("chr1", 1, 4, true, "test ");
Expand All @@ -185,6 +186,26 @@ public void testReverseComplementFailureDoesNotErrorOut() {

// we don't actually care what the results are here -- we just want to make sure that it doesn't fail
final VariantContextBuilder result = LiftoverUtils.reverseComplementVariantContext(builder.make(), interval, refSeq);
Assert.assertNotNull(result);
}


@Test
public void testReverseComplementWithRepeats() {
final VariantContextBuilder builder = new VariantContextBuilder().source("test").loc("chr1", 3, 6);
final Allele originalRef = Allele.create("CATC", true);
final Allele originalAlt = Allele.create("C", false);
builder.alleles(Arrays.asList(originalRef, originalAlt));

final Interval interval = new Interval("chr1", 3, 6, true, "test ");

final String reference = "ATGATGATGA";
final ReferenceSequence refSeq = new ReferenceSequence("chr1", 10, reference.getBytes());

// we don't actually care what the results are here -- we just want to make sure that it doesn't fail
final VariantContextBuilder result = LiftoverUtils.reverseComplementVariantContext(builder.make(), interval, refSeq);
Assert.assertNotNull(result);
Assert.assertTrue(result.getStart() > 0);
}

@DataProvider(name = "dataTestMissingContigInReference")
Expand Down Expand Up @@ -975,6 +996,31 @@ public void testLeftAlignVariants(final VariantContext source, final ReferenceSe
VcfTestUtils.assertEquals(vcb.make(), result);
}

@Test
public void testLeftAlignInRepeatingStart(){
// reference: CGTCGTCGT
// 123456789
// TCGT->T

final VariantContextBuilder builder = new VariantContextBuilder().source("test1").chr("chr1");
builder.start(3).stop(6).alleles(CollectionUtil.makeList(Allele.create("TCGT",true), Allele.create("T")));
GenotypeBuilder genotypeBuilder = new GenotypeBuilder();
genotypeBuilder.alleles(builder.getAlleles());
builder.genotypes(genotypeBuilder.make());

VariantContext vc = builder.make();
final List<Allele> origAlleles = new ArrayList<>(builder.getAlleles());

// This path mimics the codepath through the LiftoverUtils.reverseComplementVariantContext but without reverseComplementing
LiftoverUtils.leftAlignVariant(builder, vc.getStart(), vc.getEnd(), vc.getAlleles(), REFERENCE_WITH_REPEATS);
builder.genotypes(LiftoverUtils.fixGenotypes(builder.getGenotypes(), origAlleles, builder.getAlleles()));
VariantContext newVc = builder.make();
final String refString = StringUtil.bytesToString(REFERENCE_WITH_REPEATS.getBases(), newVc.getStart() - 1, newVc.getEnd() - newVc.getStart() + 1);

Assert.assertEquals(refString,"CGTC");
Copy link
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Add a space after comma

}


@DataProvider(name = "indelNoFlipData")
public Iterator<Object[]> indelNoFlipData() {

Expand Down
Loading