Issue 91

[manulera]

Hi @tnrich, working on this for #91. First 2 commits include:

• Fix to getStructuredBases to handle origin-spanning primers
• Some docs on how to run the OVE unit tests.
• The possibility to log in tests using cy.task('log', 'message'). I can revert this if you want, I used it for debugging the test.

[manulera]

Hi @tnrich see my comments regarding the logs and running test locally in the command line. If you think the use-case is not relevant I can remove them from the PR.

Regarding getStructuredBases I think passing annotationRange could be omitted. I think in all calls to getStructuredBases in the repo, the function is called with identical values in start and annotationRange.start, and same for end.

In this case clearly yes

// in helperComponents/AddOrEditPrimerDialog/index.js
const { allBasesWithMetaData } = getStructuredBases({
    annotationRange: { start: start - 1, end: end - 1 },
    forward,
    bases: basesToUse,
    start: start - 1,
    end: end - 1,
    fullSequence: sequenceData.sequence,
    primerBindsOn,
    sequenceLength
  });

In this second one, is there a case where annotation.start and annotationRange.start are different and what would it mean in a primer?

// RowItem/StackedAnnotations/primerBases.js
export function getBasesToShow({
  hidePrimerBases,
  annotation,
  annotationRange,
  charWidth,
  bpsPerRow,
  fullSequence,
  iTree,
  sequenceLength
}) {
  if (hidePrimerBases) return {};
  const basesToShow = {};
  if (annotation && annotation.bases) {
    const fudge = charWidth - realCharWidth;
    const { forward, primerBindsOn } = annotation;

    const { basesNoInsertsWithMetaData, inserts, aRange } = getStructuredBases({
      ...annotation,
      fullSequence,
      annotationRange,
      sequenceLength
    });

[manulera]

Hi @tnrich I reverted those changes, let me know what you think about the change, and if you have some advice for the displaying as mentioned in #91

[tnrich]

@manulera annotationRange is used when an annotation spans multiple rows. Try changing to this:

      name: "Right tail primer - reverse",
      start: 40,
      end: 83,
      type: "primer_bind",
      forward: false,
      color: "red",
      primerBindsOn: "5prime",
      bases: "tgcaccggggccagcccgagcgagttccgtgccggttgtgaaga"
    }

And you'll see how your changes aren't quite rendering correctly across rows:

I think you'll need to try a slightly different tweaking of the code there that preserves at least some of the annotationRange logic.

[tnrich]

@manulera any luck updating the code based off my comment ?

[manulera]

Hi @tnrich I was hoping to get this done before the holidays, but I did not manage to slot it in. Will get back to you eventually.