Clarify file format for appending probes?

[ewallace]

Could the documentation clarify the correct file format for appending custom probe sets?

The probe sets in https://github.com/beliveau-lab/PaintSHOP/tree/master/PaintSHOP/appending all have tables like:

id	seq
saber_bc42_bridge0	AATTCTATGACACCGCCACGCCCTATATCCTCGCAATAACCC

However when I went from the Append Sequences tab and appended a single custom probe as .tsv with columns id, seq it did't work; instead when I had a text file that only contained the probe sequence it worked:
smiFISH_probe_ZFLAP.txt

It would be helpful to clarify the file format in the documentation.