You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
id seq
saber_bc42_bridge0 AATTCTATGACACCGCCACGCCCTATATCCTCGCAATAACCC
However when I went from the Append Sequences tab and appended a single custom probe as .tsv with columns id, seq it did't work; instead when I had a text file that only contained the probe sequence it worked: smiFISH_probe_ZFLAP.txt
It would be helpful to clarify the file format in the documentation.
The text was updated successfully, but these errors were encountered:
Could the documentation clarify the correct file format for appending custom probe sets?
The probe sets in https://github.com/beliveau-lab/PaintSHOP/tree/master/PaintSHOP/appending all have tables like:
However when I went from the Append Sequences tab and appended a single custom probe as .tsv with columns
id, seq
it did't work; instead when I had a text file that only contained the probe sequence it worked:smiFISH_probe_ZFLAP.txt
It would be helpful to clarify the file format in the documentation.
The text was updated successfully, but these errors were encountered: