Why all mutations are judged Benign or Uncertain significance?

[yinbinqiu]

I used intervar to predict mutations and found no pathogenic entries, what went wrong?

In addition, I found that some loci are contradictory, such as the situation that PM1 and BS1 are satisfied at the same time? How to deal with such a result?

[GinaLei]

Hi! Have you solved your problem? I encounter the same problem now. When I annotate the variants with the Intervar database in ANNOVAR, many were predicted as pathogenic. But when I use InterVar to predict the same variants, all of them were predicted as benign or VUS. It confuses me a lot.

[adeffur]

When I switched to hg38, InterVar predicts no pathogenic variants; all end up as benign or VUS. I'm using Intervar_20210727, with default ANNOVAR databases as hardcoded in intervar.py.
Is there something I'm missing?

[quanliustc]

how you run the hg38 version, please provide the cmd(maybe post the screen output) and also some top lines of your variant input.

[adeffur]

1. Input vcf (vcf4.3) converted to avinput using convert2annovar.pl

2. Run command:
   python Intervar.py -i ${av_file} -o ${out_file} -c config.ini
   where av_file is in avinput
   config.ini
   buildver = hg38
   All other entries left as default.

3. top lines of vcf:
   ##fileformat=VCFv4.3 ##fileDate=05/27/24 ##reference=hg38_2024 ##source=SEQUENCE Pilot_5.4.1 ##InputFileList=../Import/20240521_Twist-PCDv2_hg38-2_illumina/24072-01-01_S2_L001_R1_001.fastq.gz;../Import/20240521_Twist-PCDv2_hg38-2_illumina/24072-01-01_S2_L001_R2_001.fastq.gz ##INFO=<ID=Illumina-50x,Number=0,Type=Flag,Description="Analysis Settings Flag; [Settings];Profile: Illumina-50x;Reads include PCR primers: auto;Randomly sheared reads: no;Genome mapping: yes;Single / double direction analysis /;Both dir. min abs. cov.: 19;Both dir. min % cov.: off;Required Coverage /;Min abs. cov.: 10 per dir.;Ratio read dir.: off;Mutations /;Min abs. cov.: off;Ratio read dir.: off;Min % cov.: 10% per dir.;Force combined % cov.:off;Min & cov. homozygosity:85%;Mutation sorting /;Distinct/other cov.: 15% per dir.;Distinct/homop. cov. (deletion) : 40% per dir.;Distinct/homop. cov. (insertion): off per dir.;Homop. region size: 7;Expected Coverage Warning /;Min abs. cov.: 50;[Quality Score];Score thresh.: 15;Ignore reads thres.: 40%;Score cov. warning: off;Score read grouping: yes;[Trimming];Adaptor /;5': ; Error rate: 10; Overlap: 3abs;3': ; Error rate: 10; Overlap: 3abs;Remove bases: 0 (5') / 0 (3') ;[BAM/SAM];Genome from BAM / SAM: ;Mapping: yes;Alignment: yes;Unfiltered: no;[Tags];active: no;R1 tag length: 0;R2 tag length: 0;Min abs. cov. cons.: off;Min per. cov. cons.: off;Ignore cons. read thresh.: off;Ignore N tags: no;Ignore low Qs tags: no;[Fusions];active: no;Mode: open (exome only);Min abs. cov.: 10;Breakpoint spread.: 3;[Expert Settings];Base calling /;Genome Set: Diploid;Unique reads only: no;Read processing /;Compl. reads only: no;Barcode at 5' and 3': no;Ignore paired end info: no;Allow unique paired end reads: no;Require identical paired end overlap: no;Trim amplicons only: no;R1 / R2 read coloring: no;Gene specific primers: no;Alignment evaluation /;Skip evaluation: no;Max mismatches: 15%;Min matching bases: 50%;Keep strong consensus: 50%;Mutation table /;Warning: 50%;InDel gap SNP to SNP: 3;InDel gap SNP to InDel: 3;"> ##INFO=<ID=ModifiedSettings,Number=.,Type=String,Description="Individual modifications of ROI settings wrt. to the settings indicated by the 'Analysis Settings Flag'."> ##INFO=<ID=GI,Number=.,Type=String,Description="Gene ID"> ##INFO=<ID=TI,Number=.,Type=String,Description="Transcript ID"> ##INFO=<ID=WEIGHTING,Number=.,Type=String,Description="Variation and Mutation sorting (distinct, other, homopolymer, filter, temp. filter)"> ##INFO=<ID=ClinVitae:Classification,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=gnomAD:AC,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=gnomAD:AF,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=gnomAD:AN,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=gnomAD:Hom,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=ClinVar:Clinical Significance,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=1000Genomes:AF,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=dbSNP:MAF,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=ExAC:AC,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=ExAC:AF,Number=.,Type=String,Description="Mutation Info from Public DBs"> ##INFO=<ID=COVFR,Number=2,Type=Integer,Description="# alt-forward reads, alt-reverse reads; for wildtype positions ref-forward reads and ref-reverse reads"> ##INFO=<ID=CHGVS,Number=.,Type=String,Description="Codon change based on selected TI in HGVS nomenclature format"> ##INFO=<ID=PHGVS,Number=.,Type=String,Description="Protein change based on selected TI in HGVS nomenclature format"> ##FILTER=<ID=Illumina-50x,Description="Profile selected in Run Window of SeqNext module"> ##FILTER=<ID=q15,Description="Quality below or equal15"> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read depth at this position for this sample"> ##FORMAT=<ID=AF,Number=A,Type=Float,Description="Allele frequency for each ALT allele in the same order as listed"> ##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Total read depth for each allele"> ##FORMAT=<ID=ADF,Number=R,Type=Integer,Description="Read depth for each allele on the forward strand"> ##FORMAT=<ID=ADR,Number=R,Type=Integer,Description="Read depth for each allele on the reverse strand"> #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 1 1922176 rs3039777 T TCTGA . PASS GI=CFAP74;TI=NM_001304360.2;Illumina-50x;WEIGHTING=distinct;dbSNP:MAF=0.975000;COVFR=1044,1037;CHGVS=c.*110_*111insTCAG GT:DP:AF:AD:ADF:ADR 1/1:2226:0.93:145,2081:79,1044:66,1037 1 1930142 rs141833643 C A . PASS GI=CFAP74;TI=NM_001304360.2;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=1037;gnomAD:AF=0.007712;gnomAD:AN=134462;dbSNP:MAF=0.004553;COVFR=950,979;CHGVS=c.3206G>T;PHGVS=p.(Gly1069Val) GT:DP:AF:AD:ADF:ADR 0/1:3885:0.50:1956,1929:969,950:987,979 1 1968747 rs35269416 T C . PASS GI=CFAP74;TI=NM_001304360.2;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=46962;gnomAD:AF=0.188203;gnomAD:AN=249528;dbSNP:MAF=0.111100;COVFR=1890,1655;CHGVS=c.1133A>G;PHGVS=p.(Lys378Arg) GT:DP:AF:AD:ADF:ADR 1/1:3556:1.00:11,3545:6,1890:5,1655 1 1968793 rs16824588 T C . PASS GI=CFAP74;TI=NM_001304360.2;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=105280;gnomAD:AF=0.422052;gnomAD:AN=249448;dbSNP:MAF=0.228900;COVFR=1985,1183;CHGVS=c.1087A>G;PHGVS=p.(Ile363Val) GT:DP:AF:AD:ADF:ADR 1/1:3170:1.00:2,3168:1,1985:1,1183 1 1987049 rs4350140 A G . PASS GI=CFAP74;TI=NM_001304360.2;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=130882;gnomAD:AF=0.552189;gnomAD:AN=237024;dbSNP:MAF=0.380100;COVFR=584,430;CHGVS=c.297-14T>C GT:DP:AF:AD:ADF:ADR 0/1:1995:0.51:981,1014:572,584:409,430 1 3682336 rs2273953 G A . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=27759;gnomAD:AF=0.203238;gnomAD:AN=136584;dbSNP:MAF=0.075000;COVFR=647,524;CHGVS=c.-30G>A GT:DP:AF:AD:ADF:ADR 0/1:2803:0.42:1632,1171:876,647:756,524 1 3682346 rs1801173 C T . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=30400;gnomAD:AF=0.201790;gnomAD:AN=150652;dbSNP:MAF=0.075000;COVFR=657,586;CHGVS=c.-20C>T GT:DP:AF:AD:ADF:ADR 0/1:2943:0.42:1700,1243:877,657:823,586 1 3690956 rs3765730 G A . PASS GI=TP73;TI=NM_001126242.3;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=59098;gnomAD:AF=0.312130;gnomAD:AN=189338;dbSNP:MAF=0.226700;COVFR=276,497;CHGVS=c.39+12G>A GT:DP:AF:AD:ADF:ADR 0/1:1596:0.48:823,773:318,276:505,497 1 3722110 rs1801174 C T . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=200645;gnomAD:AF=0.803776;gnomAD:AN=249628;dbSNP:MAF=0.441600;COVFR=1187,962;CHGVS=c.519C>T;PHGVS=p.(Thr173%3D) GT:DP:AF:AD:ADF:ADR 1/1:2149:1.00:0,2149:0,1187:0,962 1 3727785 rs2181486 A G . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=90543;gnomAD:AF=0.689463;gnomAD:AN=131324;dbSNP:MAF=0.228500;COVFR=800,1419;CHGVS=c.985+15A>G GT:DP:AF:AD:ADF:ADR 1/1:2231:0.99:12,2219:9,800:3,1419 1 3733919 rs34408700 CT C . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=homopolymer;dbSNP:MAF=0.026710;COVFR=204,183;CHGVS=c.*858del GT:DP:AF:AD:ADF:ADR 0/1:3044:0.13:2657,387:1297,204:1360,183 1 3733919 rs34408700 C CT . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=distinct;dbSNP:MAF=0.347000;COVFR=496,521;CHGVS=c.*858dup GT:DP:AF:AD:ADF:ADR 0/1:3066:0.33:2049,1017:1005,496:1044,521 1 3733919 rs34408700 C CTT . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=other;dbSNP:MAF=0.026390;COVFR=161,165;CHGVS=c.*857_*858dup GT:DP:AF:AD:ADF:ADR 0/1:3066:0.11:2740,326:1340,161:1400,165 1 3734534 rs1181869 C T . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=distinct;dbSNP:MAF=0.275400;COVFR=637,871;CHGVS=c.*1455C>T GT:DP:AF:AD:ADF:ADR 0/1:2897:0.52:1389,1508:592,637:797,871 1 3734562 rs1181868 G T . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=distinct;dbSNP:MAF=0.274000;COVFR=590,555;CHGVS=c.*1483G>T GT:DP:AF:AD:ADF:ADR 0/1:2295:0.50:1150,1145:588,590:562,555 1 3734754 rs1181867 A G . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=distinct;dbSNP:MAF=0.422500;COVFR=644,670;CHGVS=c.*1675A>G GT:DP:AF:AD:ADF:ADR 0/1:2765:0.48:1451,1314:691,644:760,670 1 3736053 rs1047928 G C . PASS GI=TP73;TI=NM_005427.4;Illumina-50x;WEIGHTING=distinct;dbSNP:MAF=0.012300;COVFR=780,781;CHGVS=c.*2974G>C GT:DP:AF:AD:ADF:ADR 0/1:3368:0.46:1807,1561:957,780:850,781 1 37557715 rs11749 C T . PASS GI=DNALI1;TI=NM_003462.5;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=60135;gnomAD:AF=0.239979;gnomAD:AN=250584;dbSNP:MAF=0.175700;COVFR=463,588;CHGVS=c.194C>T;PHGVS=p.(Ala65Val) GT:DP:AF:AD:ADF:ADR 0/1:2317:0.45:1266,1051:576,463:690,588 1 37565095 rs6619 T C . PASS GI=DNALI1;TI=NM_003462.5;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=114505;gnomAD:AF=0.455759;gnomAD:AN=251240;dbSNP:MAF=0.345100;COVFR=828,773;CHGVS=c.*34T>C GT:DP:AF:AD:ADF:ADR 0/1:3501:0.46:1900,1601:973,828:927,773 1 43186698 rs6413971 T C . PASS GI=CFAP57;TI=NM_001378189.1;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=251312;gnomAD:AF=0.999332;gnomAD:AN=251480;dbSNP:MAF=0.996600;COVFR=1170,732;CHGVS=c.970-9T>C GT:DP:AF:AD:ADF:ADR 1/1:1906:1.00:4,1902:4,1170:0,732 1 43197705 rs513009 A G . PASS GI=CFAP57;TI=NM_001378189.1;Illumina-50x;WEIGHTING=distinct;gnomAD:AC=209776;gnomAD:AF=0.834478;gnomAD:AN=251386;dbSNP:MAF=0.629100;COVFR=1001,1428;CHGVS=c.1262+13A>G GT:DP:AF:AD:ADF:ADR 1/1:2436:1.00:7,2429:7,1001:0,1428

4. Top lines of avinput:

1 1922176 1922176 - CTGA hom . 2226 1 1930142 1930142 C A het . 3885 1 1968747 1968747 T C hom . 3556 1 1968793 1968793 T C hom . 3170 1 1987049 1987049 A G het . 1995 1 3682336 3682336 G A het . 2803 1 3682346 3682346 C T het . 2943 1 3690956 3690956 G A het . 1596 1 3722110 3722110 C T hom . 2149 1 3727785 3727785 A G hom . 2231 1 3733920 3733920 T - het . 3044 1 3733919 3733919 - T het . 3066 1 3733919 3733919 - TT het . 3066 1 3734534 3734534 C T het . 2897 1 3734562 3734562 G T het . 2295 1 3734754 3734754 A G het . 2765 1 3736053 3736053 G C het . 3368 1 37557715 37557715 C T het . 2317 1 37565095 37565095 T C het . 3501 1 43186698 43186698 T C hom . 1906 1 43197705 43197705 A G hom . 2436 1 43198547 43198547 C T het . 3663 1 43198649 43198649 A - het . 1447 1 43209796 43209796 G A hom . 4505 1 43234264 43234264 C T hom . 1856 1 43991633 43991633 G A het . 2849 1 45620180 45620180 C T het . 3214 1 45620207 45620207 C G het . 3119 1 45620405 45620405 C T het . 998 1 45621905 45621905 G A het . 1993 1 45623553 45623553 C G het . 3394 1 45624580 45624580 A G het . 3311 1 66814198 66814198 C A hom . 2099 1 66862211 66862211 A G hom . 3283 1 66924733 66924733 G C hom . 2494 1 66924785 66924785 C G hom . 2110 1 78112493 78112493 T C het . 5012 1 85062323 85062323 C A hom . 2442 1 85093436 85093436 T - het . 2000 1 85108022 85108022 - C het . 3027 1 85124257 85124257 T - het . 2360 1 85128783 85128783 G A het . 2167 1 85132845 85132845 C - hom . 2078 1 118023330 118023330 G A het . 2118 1 118040785 118040785 G A het . 3384 1 118101807 118101807 A G het . 4155 1 156525729 156525729 - AAAA het . 2934 1 156525729 156525729 - AA het . 2934 1 156525729 156525729 - AAA het . 2934 1 156526396 156526396 A G hom . 2270 1 156556595 156556595 C G hom . 3103 1 156556652 156556652 T C hom . 3023 1 156563116 156563116 C A hom . 692 1 156563185 156563185 T C hom . 2628 1 156566429 156566429 G C hom . 2577 1 156566459 156566459 T C hom . 3340 1 156566561 156566561 A G hom . 1493 1 156569362 156569362 T C hom . 1548 1 159884461 159884461 T C het . 2532 1 159888493 159888493 - ACACTGACACAAGAATAAACAGAGTTAGGGAGGGGAGAGGGAAAGCTCTCAGCACC het . 2472 1 159888500 159888500 T A het . 1653 1 159890469 159890469 G A het . 2427 1 169303213 169303215 AGG TGA het . 3416

5. Some lines of intervar output:

#Chr Start End Ref Alt Ref.Gene Func.refGene ExonicFunc.refGene Gene.ensGene avsnp147 AAChange.ensGene AAChange.refGene clinvar: Clinvar InterVar: InterVar and Evidence Freq_gnomAD_genome_ALL Freq_esp6500siv2_all Freq_1000g2015aug_all CADD_raw CADD_phred SIFT_score GERP++_RS phyloP46way_placental dbscSNV_ADA_SCORE dbscSNV_RF_SCORE Interpro_domain AAChange.knownGene rmsk MetaSVM_score Freq_gnomAD_genome_POPs OMIM Phenotype_MIM OrphaNumber Orpha Otherinfo 1 1922176 1922176 - CTGA CFAP74 UTR3 . CFAP74 rs113294876 . . clinvar: UNK InterVar: Benign PVS1=0 PS=[0, 0, 0, 0, 0] PM=[0, 0, 0, 0, 0, 0, 0] PP=[0, 0, 0, 0, 0, 0] BA1=1 BS=[1, 0, 0, 0, 0] BP=[0, 0, 0, 0, 0, 0, 0, 0] 0.9996 . 0.9998 . . . . . . . . . . . AFR:0.9997,AMR:1,EAS:1,FIN:1,NFE:0.9994,OTH:1,ASJ:1 620187 . hom 1 1930142 1930142 C A CFAP74 exonic nonsynonymous SNV CFAP74 rs141833643 CFAP74:ENST00000493964.5:exon26:c.G3206T:p.G1069V,CFAP74:ENST00000682832.2:exon26:c.G3206T:p.G1069V CFAP74:NM_001304360:exon26:c.G3206T:p.G1069V clinvar: UNK InterVar: Uncertain significance PVS1=0 PS=[0, 0, 0, 0, 0] PM=[0, 0, 0, 0, 0, 0, 0] PP=[0, 0, 0, 0, 0, 0] BA1=0 BS=[1, 0, 0, 0, 0] BP=[0, 0, 0, 0, 0, 0, 0, 0] 0.0070 . 0.00499201 3.426 24.5 . 3.29 . . . . CFAP74:ENST00000493964.5:exon26:c.G3206T:p.G1069V,ENST00000682832.2:ENST00000682832.2:exon26:c.G3206T:p.G1069V . -1.085 AFR:0.0018,AMR:0.0084,EAS:0,FIN:0.0117,NFE:0.0094,OTH:0.0102,ASJ:0.0066 620187 . het 1 1968747 1968747 T C CFAP74 exonic nonsynonymous SNV CFAP74 rs35269416 CFAP74:ENST00000493964.5:exon11:c.A1133G:p.K378R,CFAP74:ENST00000682832.2:exon11:c.A1133G:p.K378R CFAP74:NM_001304360:exon11:c.A1133G:p.K378R clinvar: UNK InterVar: Benign PVS1=0 PS=[0, 0, 0, 0, 0] PM=[0, 0, 0, 0, 0, 0, 0] PP=[0, 0, 0, 0, 0, 0] BA1=1 BS=[1, 0, 0, 0, 0] BP=[0, 0, 0, 1, 0, 0, 0, 0] 0.1447 0.1632 0.153954 -0.122 0.747 . -3.57 . . . . CFAP74:ENST00000493964.5:exon11:c.A1133G:p.K378R,ENST00000682832.2:ENST00000682832.2:exon11:c.A1133G:p.K378R . -1.055 AFR:0.0821,AMR:0.2170,EAS:0.1177,FIN:0.1431,NFE:0.1761,OTH:0.1609,ASJ:0.3013 620187 . hom 1 1968793 1968793 T C CFAP74 exonic nonsynonymous SNV CFAP74 rs16824588 CFAP74:ENST00000493964.5:exon11:c.A1087G:p.I363V,CFAP74:ENST00000682832.2:exon11:c.A1087G:p.I363V CFAP74:NM_001304360:exon11:c.A1087G:p.I363V clinvar: UNK InterVar: Benign PVS1=0 PS=[0, 0, 0, 0, 0] PM=[0, 0, 0, 0, 0, 0, 0] PP=[0, 0, 0, 0, 0, 0] BA1=1 BS=[1, 0, 0, 0, 0] BP=[0, 0, 0, 1, 0, 0, 0, 0] 0.4151 0.4351 0.38778 -0.479 0.132 . 1.74 . . . . CFAP74:ENST00000493964.5:exon11:c.A1087G:p.I363V,ENST00000682832.2:ENST00000682832.2:exon11:c.A1087G:p.I363V . -0.921 AFR:0.4367,AMR:0.4318,EAS:0.3090,FIN:0.3855,NFE:0.4183,OTH:0.4035,ASJ:0.5364 620187 . hom 1 1987049 1987049 A G CFAP74 intronic . CFAP74 rs4350140 . . clinvar: UNK InterVar: Benign PVS1=0 PS=[0, 0, 0, 0, 0] PM=[0, 0, 0, 0, 0, 0, 0] PP=[0, 0, 0, 0, 0, 0] BA1=1 BS=[1, 0, 0, 0, 0] BP=[0, 0, 0, 0, 0, 0, 0, 0] 0.6103 0.6404 0.630591 . . . . . . . . . . . AFR:0.8743,AMR:0.4737,EAS:0.5167,FIN:0.5109,NFE:0.5021,OTH:0.5368,ASJ:0.6192 620187 . het 1 3682336 3682336 G A TP73 UTR5 . TP73 rs2273953 . . clinvar: UNK InterVar: Benign PVS1=0 PS=[0, 0, 0, 0, 0] PM=[0, 0, 0, 0, 0, 0, 0] PP=[0, 0, 0, 0, 0, 0] BA1=1 BS=[1, 0, 0, 0, 0] BP=[0, 0, 0, 0, 0, 0, 0, 0] 0.1726 0.1757 0.177516 . . . . . . . . . . . AFR:0.1272,AMR:0.2482,EAS:0.2209,FIN:0.1807,NFE:0.1872,OTH:0.1714,ASJ:0.1987 601990 . het 1 3682346 3682346 C T TP73 UTR5 . TP73 rs1801173 . . clinvar: UNK InterVar: Benign PVS1=0 PS=[0, 0, 0, 0, 0] PM=[0, 0, 0, 0, 0, 0, 0] PP=[0, 0, 0, 0, 0, 0] BA1=1 BS=[1, 0, 0, 0, 0] BP=[0, 0, 0, 0, 0, 0, 0, 0] 0.1724 0.1764 0.177915 . . . . . . . . . . . AFR:0.1268,AMR:0.25,EAS:0.2205,FIN:0.1809,NFE:0.1871,OTH:0.1714,ASJ:0.1987 601990 . het 1 3690956 3690956 G A TP73 intronic . TP73 rs3765730 . . clinvar: UNK InterVar: Benign PVS1=0 PS=[0, 0, 0, 0, 0] PM=[0, 0, 0, 0, 0, 0, 0] PP=[0, 0, 0, 0, 0, 0] BA1=1 BS=[1, 0, 0, 0, 0] BP=[0, 0, 0, 0, 0, 0, 0, 0] 0.2904 0.2643 0.236821 . . . . . . . . . . . AFR:0.0662,AMR:0.2697,EAS:0.3817,FIN:0.4061,NFE:0.3812,OTH:0.3627,ASJ:0.2667 601990 . het 1 3722110 3722110 C T TP73 exonic synonymous SNV TP73 rs1801174 TP73:ENST00000378280.5:exon3:c.C372T:p.T124T,TP73:ENST00000378285.5:exon3:c.C372T:p.T124T,TP73:ENST00000378288.8:exon3:c.C372T:p.T124T,TP73:ENST00000378290.4:exon3:c.C306T:p.T102T,TP73:ENST00000603362.5:exon4:c.C519T:p.T173T,TP73:ENST00000604479.5:exon4:c.C519T:p.T173T,TP73:ENST00000346387.8:exon5:c.C519T:p.T173T,TP73:ENST00000354437.8:exon5:c.C519T:p.T173T,TP73:ENST00000357733.7:exon5:c.C519T:p.T173T,TP73:ENST00000378295.9:exon5:c.C519T:p.T173T,TP73:ENST00000604074.5:exon5:c.C519T:p.T173T TP73:NM_001126240:exon3:c.C372T:p.T124T,TP73:NM_001126241:exon3:c.C372T:p.T124T,TP73:NM_001126242:exon3:c.C372T:p.T124T,TP73:NM_001204189:exon3:c.C372T:p.T124T,TP73:NM_001204190:exon3:c.C372T:p.T124T,TP73:NM_001204191:exon3:c.C372T:p.T124T,TP73:NM_001204192:exon3:c.C306T:p.T102T,TP73:NM_001204184:exon5:c.C519T:p.T173T,TP73:NM_001204185:exon5:c.C519T:p.T173T,TP73:NM_001204186:exon5:c.C519T:p.T173T,TP73:NM_001204187:exon5:c.C519T:p.T173T,TP73:NM_001204188:exon5:c.C519T:p.T173T,TP73:NM_005427:exon5:c.C519T:p.T173T clinvar: UNK InterVar: Benign PVS1=0 PS=[0, 0, 0, 0, 0] PM=[0, 0, 0, 0, 0, 0, 0] PP=[0, 0, 0, 0, 0, 0] BA1=1 BS=[1, 0, 0, 0, 0] BP=[0, 0, 0, 1, 0, 0, 1, 0] 0.8295 0.8495 0.736022 . . . . . . . . TP73:ENST00000378280.5:exon3:c.C372T:p.T124T,TP73:ENST00000378285.5:exon3:c.C372T:p.T124T,TP73:ENST00000378288.8:exon3:c.C372T:p.T124T,TP73:ENST00000378290.4:exon3:c.C306T:p.T102T,TP73:ENST00000603362.5:exon4:c.C519T:p.T173T,TP73:ENST00000604479.5:exon4:c.C519T:p.T173T,TP73:ENST00000346387.8:exon5:c.C519T:p.T173T,TP73:ENST00000354437.8:exon5:c.C519T:p.T173T,TP73:ENST00000357733.7:exon5:c.C519T:p.T173T,TP73:ENST00000378295.9:exon5:c.C519T:p.T173T,TP73:ENST00000604074.5:exon5:c.C519T:p.T173T . . AFR:0.7682,AMR:0.6408,EAS:0.5260,FIN:0.8641,NFE:0.8957,OTH:0.8684,ASJ:0.9338 601990 . hom

I hope this is helpful

[adeffur]

Here is the stdout output of intervar after the run

iv_log.txt