aligner_seed2.h

/*
 * Copyright 2011, Ben Langmead <langmea@cs.jhu.edu>
 *
 * This file is part of Bowtie 2.
 *
 * Bowtie 2 is free software: you can redistribute it and/or modify
 * it under the terms of the GNU General Public License as published by
 * the Free Software Foundation, either version 3 of the License, or
 * (at your option) any later version.
 *
 * Bowtie 2 is distributed in the hope that it will be useful,
 * but WITHOUT ANY WARRANTY; without even the implied warranty of
 * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
 * GNU General Public License for more details.
 *
 * You should have received a copy of the GNU General Public License
 * along with Bowtie 2.  If not, see <http://www.gnu.org/licenses/>.
 */

#ifndef ALIGNER_SEED2_H_
#define ALIGNER_SEED2_H_

/**
 * The user of the DescentDriver class specifies a collection of search roots.
 * Logic for picking these search roots is located elsewhere, not in this
 * module.  The search roots are annotated with a priority score, which 
 *
 * The heap is a min-heap over pairs, where the first element of each pair is
 * the score associated with a descent and the second element of each pair is
 * the descent ID.
 *
 * Weeding out redundant descents is key; otherwise we end up reporting slight
 * variations on the same alignment repeatedly, including variations with poor
 * scores.  What criteria do we use to determine whether two paths are
 * redundant?
 *
 * Here's an example where the same set of read characters have been aligned in
 * all three cases:
 *
 * Alignment 1 (sc = 0):
 * Rd: GCTATATAGCGCGCTCGCATCATTTTGTGT
 *     ||||||||||||||||||||||||||||||
 * Rf: GCTATATAGCGCGCTCGCATCATTTTGTGT
 *
 * Alignment 2 (sc = -22):
 * Rd: GCTATATAGCGCGCTCGCATCATTTTGTGT
 *     |||||||||||||||||||||||  | |||
 * Rf: GCTATATAGCGCGCTCGCATCAT--TTTGT
 *
 * Alignment 3 (sc = -22):
 * Rd: GCTATATAGCGCGCTCGCATCATT--TTGTGT
 *     ||||||||||||||||||||||||   |||||
 * Rf: GCTATATAGCGCGCTCGCATCATTTTGTGTGT
 *
 * Rf from aln 1: GCTATATAGCGCGCTCGCATCATTTTGTGT
 * Rf from aln 2: GCTATATAGCGCGCTCGCATCATTTTGT
 * Rf from aln 3: GCTATATAGCGCGCTCGCATCATTTTGTGTGT
 *
 * Are alignments 2 and 3 redundant with alignment 1?  We can't totally say
 * without knowing the associated SA ranges.  Take alignments 1 and 2.  Either
 * the SA ranges are the same or the SA range for 2 contains the SA range for
 * 1.  If they're the same, then alignment 2 is redundant with alignment 1.
 * Otherwise, *some* of the elements in the SA range for alignment 2 are not
 * redundant.
 *
 * In that example, the same read characters are aligned in all three
 * alignments.  Is it possible and profitable to consider scenarios where an
 * alignment might be redundant with another alignment 
 *
 * Another question is *when* do we try to detect the redundancy?  Before we
 * try to extend through the matches, or after.  After is easier, but less work
 * has been avoided.
 *
 * What data structure do we query to determine whether there's redundancy?
 * The situation is harder when we try to detect overlaps between SA ranges
 * rather than identical SA ranges.  Maybe: read intervals -> intersection tree -> penalties.
 *
 * 1. If we're introducing a gap and we could have introduced it deeper in the
 *    descent with the same effect w/r/t homopolymer length.
 * 2. If we have Descent A with penalty B and Descent a with penalty b, and A
 *    aligns read characters [X, Y] to SA range [Z, W], and B aligns read
 *    characters [x, y] to SA range [z, w], then A is redundant with B if
 *    [x, y] is within [X, Y].
 *
 * Found an alignment with total penalty = 3
 * GCAATATAGCGCGCTCGCATCATTTTGTGT
 * || |||||||||||||||||||||||||||
 * GCTATATAGCGCGCTCGCATCATTTTGTGT
 *
 * Found an alignment with total penalty = 27
 * gCAATATAGCGCGCTCGCATCATTTTGTGT
 *   |   ||||||||||||||||||||||||
 *  TATA-TAGCGCGCTCGCATCATTTTGTGT
 */

#include <stdint.h>
#include <math.h>
#include <utility>
#include <limits>
#include "assert_helpers.h"
#include "random_util.h"
#include "aligner_result.h"
#include "bt2_idx.h"
#include "simple_func.h"
#include "scoring.h"
#include "edit.h"
#include "read.h"
#include "ds.h"
#include "group_walk.h"
#include "btypes.h"

typedef size_t   TReadOff;
typedef int64_t  TScore;
typedef float    TRootPri;
typedef size_t   TDescentId;
typedef size_t   TRootId;

/**
 * enum encapsulating a few different policies for how we might extend descents
 * in the direction opposite from their primary direction.  
 */
enum {
	// Never extened in the direction opposite from the primary.  Just go in
	// the primary direction until the bounce.
	DESC_EX_NONE = 1,
	
	// When we're finished extending out the matches for a descent, try to
	// extend in the opposite direction in a way that extends all branches
	// simultaneously.  The Descent.nex_ field contains the number of positions
	// we were able to extend through in this way.
	DESC_EX_FROM_1ST_BRANCH = 2,
	
	// Each time we add an edge to the summary, extend it in the opposite
	// direction.  The DescentEdge.nex field contains the number of positions
	// we were able to extend through, and this in turn gets propagated to
	// Descent.nex_ if and when we branch from the DescentEdge.
	DESC_EX_EACH_EDGE = 3
};

/**
 * Counters to keep track of how much work is being done.
 */
struct DescentMetrics {

	DescentMetrics() { reset(); }

	void reset() {
		bwops = bwops_1 = bwops_bi = recalc = branch = branch_mm =
		branch_del = branch_ins = heap_max = descent_max = descentpos_max = 
		nex = 0;
	}

	uint64_t bwops;          // # FM Index opbs
	uint64_t bwops_1;        // # LF1 FM Index opbs
	uint64_t bwops_bi;       // # BiEx FM Index opbs
	uint64_t recalc;         // # times outgoing edge summary was recalculated
	uint64_t branch;         // # times we descended from another descent
	uint64_t branch_mm;      // # times branch was on a mismatch
	uint64_t branch_del;     // # times branch was on a deletion
	uint64_t branch_ins;     // # times branch was on a insertion
	uint64_t heap_max;       // maximum size of Descent heap
	uint64_t descent_max;    // maximum size of Descent factory
	uint64_t descentpos_max; // maximum size of DescentPos factory
	uint64_t nex;            // # extensions
};

/**
 * Priority used to rank which descent we should branch from next.  Right now,
 * priority is governed by a 4-tuple.  From higher to lower priority:
 *
 *  1. Penalty accumulated so far
 *  2. Depth into the search space, including extensions
 *  3. Width of the SA range (i.e. uniqueness)
 *  4. Root priority
 */
struct DescentPriority {

	DescentPriority() { reset(); }

	DescentPriority(
		TScore pen_,
		size_t depth_,
		TIndexOffU width_,
		float rootpri_)
	{
		pen = pen_;
		depth = depth_;
		width = width_;
		rootpri = rootpri_;
	}
	
	/**
	 * Initialize new DescentPriority.
	 */
	void init(TScore pen_, size_t depth_, TIndexOffU width_, float rootpri_) {
		pen = pen_;
		depth = depth_;
		width = width_;
		rootpri = rootpri_;
	}
	
	/**
	 * Reset to uninitialized state.
	 */
	void reset() {
		width = 0;
	}
	
	/**
	 * Return true iff DescentPriority is initialized.
	 */
	bool inited() const {
		return width > 0;
	}
	
	/**
	 * Return true iff this priority is prior to given priority.
	 */
	bool operator<(const DescentPriority& o) const {
		assert(inited());
		assert(o.inited());
		// 1st priority: penalty accumulated so far
		if(pen < o.pen) return true;
		if(pen > o.pen) return false;
		// 2nd priority: depth into the search space, including extensions
		if(depth > o.depth) return true;
		if(depth < o.depth) return false;
		// 3rd priority: width of the SA range (i.e. uniqueness)
		if(width < o.width) return true;
		if(width > o.width) return false;
		// 4th priority: root priority
		if(rootpri > o.rootpri) return true;
		return false;
	}

	/**
	 * Return true iff this priority is prior to or equal to given priority.
	 */
	bool operator<=(const DescentPriority& o) const {
		assert(inited());
		assert(o.inited());
		// 1st priority: penalty accumulated so far
		if(pen < o.pen) return true;
		if(pen > o.pen) return false;
		// 2nd priority: depth into the search space, including extensions
		if(depth > o.depth) return true;
		if(depth < o.depth) return false;
		// 3rd priority: width of the SA range (i.e. uniqueness)
		if(width < o.depth) return true;
		if(width > o.width) return false;
		// 4th priority: root priority
		if(rootpri > o.rootpri) return true;
		return true;
	}

	/**
	 * Return true iff this priority is prior to or equal to given priority.
	 */
	bool operator==(const DescentPriority& o) const {
		assert(inited());
		assert(o.inited());
		return pen == o.pen && depth == o.depth && width == o.width && rootpri == o.rootpri;
	}

	TScore pen;      // total penalty accumulated so far
	size_t depth;    // depth from root of descent
	TIndexOffU width; // width of the SA range
	float  rootpri;  // priority of the root
};

static inline std::ostream& operator<<(
	std::ostream& os,
	const DescentPriority& o)
{
	os << "[" << o.pen << ", " << o.depth << ", " << o.width << ", " << o.rootpri << "]";
	return os;
}

static inline std::ostream& operator<<(
	std::ostream& os,
	const std::pair<DescentPriority, TDescentId>& o)
{
	os << "{[" << o.first.pen << ", " << o.first.depth << ", "
	   << o.first.width << ", " << o.first.rootpri << "], " << o.second << "}";
	return os;
}

typedef std::pair<DescentPriority, TDescentId> TDescentPair;

/**
 * Encapsulates the constraints limiting which outgoing edges are permitted.
 * Specifically, we constrain the total penalty accumulated so far so that some
 * outgoing edges will exceed the limit and be pruned.  The limit is set
 * according to our "depth" into the search, as measured by the number of read
 * characters aligned so far.  We divide the depth domain into two pieces, a
 * piece close to the root, where the penty is constrained to be 0, and the
 * remainder, where the maximum penalty is an interpolation between 0 and the
 * maximum penalty
 */
struct DescentConstraints {

	DescentConstraints() { reset(); }
	
	/**
	 * Initialize with new constraint function.
	 */
	DescentConstraints(size_t nzero, double exp) {
        init(nzero, exp);
	}
    
    /**
     * Initialize with given function.
     */
    void init(size_t nzero_, double exp_) {
		nzero = nzero_ > 0 ? nzero_ : 1;
		exp = exp_;
#ifndef NDEBUG
		for(size_t i = 1; i < nzero_ + 5; i++) {
			assert_geq(get(i, nzero_ + 10, 100), get(i-1, nzero_ + 10, 100));
		}
#endif
    }
    
    /**
     * Reset to uninitialized state.
     */
    void reset() {
        nzero = 0;
		exp = -1.0f;
    }
    
    /**
     * Return true iff the DescentConstraints has been initialized.
     */
    bool inited() const {
        return exp >= 0.0f;
    }
	
	/**
	 * Get the maximum penalty total for depth 'off'.
	 */
	inline TScore get(TReadOff off, TReadOff rdlen, TAlScore maxpen) const {
		if(off < nzero || nzero >= rdlen) {
			return 0;
		}
		double frac = (double)(off - nzero) / (rdlen - nzero);
		if(fabs(exp - 1.0f) > 0.00001) {
			if(fabs(exp - 2.0f) < 0.00001) {
				frac *= frac;
			} else {
				frac = pow(frac, exp);
			}
		}
		return (TAlScore)(frac * maxpen + 0.5f);
	}

	size_t nzero;
	double exp;
};

/**
 * Encapsulates settings governing how we descent.
 */
struct DescentConfig {

    DescentConfig() { reset(); }
    
    /**
     * Reset the DescentConfig to an uninitialized state.
     */
    void reset() { expol = 0; }
    
    /**
     * Return true iff this DescentConfig is initialized.
     */
    bool inited() const { return expol != 0; }

    DescentConstraints cons; // constraints
    int expol; // extend policy
};

/**
 * Encapsulates the state of a Descent that allows us to determine whether it
 * is redundant with another Descent.  Two Descents are redundant if:
 *
 * 1. Both are aligning the same read orientation (fw or rc)
 * 2. Both are growing the alignment in the same direction (left-to-right or
 *    right-to-left)
 * 3. They have aligned exactly the same read characters (which are always
 *    consecutive in the read)
 * 4. The corresponding reference strings are identical
 */
struct DescentRedundancyKey {

	DescentRedundancyKey() { reset(); }
	
	DescentRedundancyKey(
		TReadOff  al5pf_,
		size_t    rflen_,
		TIndexOffU topf_,
		TIndexOffU botf_)
	{
		init(al5pf_, rflen_, topf_, botf_);
	}

	void reset() {
		al5pf = 0;
		rflen = 0;
		topf = botf = 0;
	}
	
	bool inited() const { return rflen > 0; }

	void init(
		TReadOff  al5pf_,
		size_t    rflen_,
		TIndexOffU topf_,
		TIndexOffU botf_)
	{
		al5pf = al5pf_;
		rflen = rflen_;
		topf = topf_;
		botf = botf_;
	}
	
	bool operator==(const DescentRedundancyKey& o) const {
		return al5pf == o.al5pf && rflen == o.rflen && topf == o.topf && botf == o.botf;
	}

	bool operator<(const DescentRedundancyKey& o) const {
		if(al5pf < o.al5pf) return true;
		if(al5pf > o.al5pf) return false;
		if(rflen < o.rflen) return true;
		if(rflen > o.rflen) return false;
		if(topf < o.topf) return true;
		if(topf > o.topf) return false;
		return botf < o.botf;
	}

	TReadOff al5pf; // 3'-most aligned char, as offset from 5' end
	size_t rflen;   // number of reference characters involved in alignment
	TIndexOffU topf; // top w/r/t forward index
	TIndexOffU botf; // bot w/r/t forward index
};

/**
 * Map from pairs to top, bot, penalty triples.
 */
class DescentRedundancyChecker {

public:

	DescentRedundancyChecker() { reset(); }

	void clear() { reset(); }
	
	/**
	 * Reset to uninitialized state.
	 */
	void reset() {
		bits_.reset();
		inited_ = false;
		totsz_ = 0;  // total size
		totcap_ = 0; // total capacity
	}
	
	const static int NPARTS = 8;
	const static int PART_MASK = 7;
	const static int NBITS = (1 << 16);

	/**
	 * Initialize using given read length.
	 */
	void init(TReadOff rdlen) {
		reset();
		bits_.resize(NBITS);
		maplist_fl_.resize(NPARTS);
		maplist_fr_.resize(NPARTS);
		maplist_rl_.resize(NPARTS);
		maplist_rr_.resize(NPARTS);
		for(int i = 0; i < NPARTS; i++) {
			maplist_fl_[i].resize(rdlen);
			maplist_fr_[i].resize(rdlen);
			maplist_rl_[i].resize(rdlen);
			maplist_rr_[i].resize(rdlen);
			totcap_ += maplist_fl_[i].totalCapacityBytes();
			totcap_ += maplist_fr_[i].totalCapacityBytes();
			totcap_ += maplist_rl_[i].totalCapacityBytes();
			totcap_ += maplist_rr_[i].totalCapacityBytes();
			for(size_t j = 0; j < rdlen; j++) {
				maplist_fl_[i][j].clear();
				maplist_fr_[i][j].clear();
				maplist_rl_[i][j].clear();
				maplist_rr_[i][j].clear();
				totcap_ += maplist_fl_[i][j].totalCapacityBytes();
				totcap_ += maplist_fr_[i][j].totalCapacityBytes();
				totcap_ += maplist_rl_[i][j].totalCapacityBytes();
				totcap_ += maplist_rr_[i][j].totalCapacityBytes();
			}
		}
		inited_ = true;
	}
	
	/**
	 * Return true iff the checker is initialized.
	 */
	bool inited() const {
		return inited_;
	}

	/**
	 * Check if this partial alignment is redundant with one that we've already
	 * explored.
	 */
	bool check(
		bool fw,
		bool l2r,
		TReadOff al5pi,
		TReadOff al5pf,
		size_t rflen,
		TIndexOffU topf,
		TIndexOffU botf,
		TScore pen)
	{
		assert(inited_);
		assert(topf > 0 || botf > 0);
		DescentRedundancyKey k(al5pf, rflen, topf, botf);
		size_t i = std::numeric_limits<size_t>::max();
		size_t mask = topf & PART_MASK;
		EMap<DescentRedundancyKey, TScore>& map =
			(fw ? (l2r ? maplist_fl_[mask][al5pi] : maplist_fr_[mask][al5pi]) :
			      (l2r ? maplist_rl_[mask][al5pi] : maplist_rr_[mask][al5pi]));
		size_t key = (topf & 255) | ((botf & 255) << 8);
		if(bits_.test(key) && map.containsEx(k, i)) {
			// Already contains the key
			assert_lt(i, map.size());
			assert_geq(pen, map[i].second);
			return false;
		}
		assert(!map.containsEx(k, i));
		size_t oldsz = map.totalSizeBytes();
		size_t oldcap = map.totalCapacityBytes();
		map.insert(make_pair(k, pen));
		bits_.set(key);
		totsz_ += (map.totalSizeBytes() - oldsz);
		totcap_ += (map.totalCapacityBytes() - oldcap);
		return true;
	}

	/**
	 * Check if this partial alignment is redundant with one that we've already
	 * explored using the Bw index SA range.
	 */
	bool contains(
		bool fw,
		bool l2r,
		TReadOff al5pi,
		TReadOff al5pf,
		size_t rflen,
		TIndexOffU topf,
		TIndexOffU botf,
		TScore pen)
	{
		assert(inited_);
		size_t key = (topf & 255) | ((botf & 255) << 8);
		if(!bits_.test(key)) {
			return false;
		}
		DescentRedundancyKey k(al5pf, rflen, topf, botf);
		size_t mask = topf & PART_MASK;
		EMap<DescentRedundancyKey, TScore>& map =
			(fw ? (l2r ? maplist_fl_[mask][al5pi] : maplist_fr_[mask][al5pi]) :
			      (l2r ? maplist_rl_[mask][al5pi] : maplist_rr_[mask][al5pi]));
		return map.contains(k);
	}
	
	/**
	 * Return the total size of the redundancy map.
	 */
	size_t totalSizeBytes() const {
		return totsz_;
	}

	/**
	 * Return the total capacity of the redundancy map.
	 */
	size_t totalCapacityBytes() const {
		return totcap_;
	}

protected:

	bool inited_;   // initialized?
	size_t totsz_;  // total size
	size_t totcap_; // total capacity
	
	// List of maps.  Each entry is a map for all the DescentRedundancyKeys
	// with al5pi equal to the offset into the list.
	ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_fl_; //  fw,  l2r
	ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_rl_; // !fw,  l2r
	ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_fr_; //  fw, !l2r
	ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_rr_; // !fw, !l2r
		
	EBitList<128> bits_;
};

/**
 * A search root.  Consists of an offset from the 5' end read and flags
 * indicating (a) whether we're initially heading left-to-right or
 * right-to-left, and (b) whether we're examining the read or its reverse
 * complement.
 *
 * A root also comes with a priority ("pri") score indicating how promising it
 * is as a root.  Promising roots have long stretches of high-quality,
 * non-repetitive nucleotides in the first several ply of the search tree.
 * Also, roots beginning at the 5' end of the read may receive a higher
 * priority.
 */
struct DescentRoot {

	DescentRoot() { reset(); }

	DescentRoot(
		size_t off5p_,
		bool l2r_,
		bool fw_,
		size_t landing_,
		size_t len,
		float pri_)
	{
		init(off5p_, l2r_, fw_, landing_, len, pri_);
	}
	
	/**
	 * Initialize a new descent root.
	 */
	void init(
		size_t off5p_,
		bool l2r_,
		bool fw_,
		size_t landing_,
		size_t len,
		float pri_)
	{
		off5p = off5p_;
		l2r = l2r_;
		fw = fw_;
		landing = landing_;
		pri = pri_;
		assert_lt(off5p, len);
	}
	
	/**
	 * Reset this DescentRoot to uninitialized state.
	 */
	void reset() {
		off5p = std::numeric_limits<size_t>::max();
	}
	
	/**
	 * Return true iff this DescentRoot is uninitialized.
	 */
	bool inited() const {
		return off5p == std::numeric_limits<size_t>::max();
	}
	
	/**
	 * Determine if two DescentRoots are equal.
	 */
	bool operator==(const DescentRoot& o) const {
		return pri == o.pri && off5p == o.off5p && l2r == o.l2r &&
		       fw == o.fw && landing == o.landing;
	}
	
	/**
	 * Determine the relative order of two DescentRoots.
	 */
	bool operator<(const DescentRoot& o) const {
		if(pri > o.pri)         return true;
		if(pri < o.pri)         return false;
		if(off5p < o.off5p)     return true;
		if(off5p > o.off5p)     return false;
		if(fw != o.fw)          return fw;
		if(l2r != o.l2r)        return l2r;
		if(landing < o.landing) return true;
		if(landing > o.landing) return false;
		return false; // they're equal
	}

	/**
	 * Return true iff this DescentRoot is either less than or equal to o.
	 */
	bool operator<=(const DescentRoot& o) const {
		return (*this) < o || (*this) == o;
	}

	// Maybe add an array of bools indicating how the landing area of this
	// root overlaps landing areas of already-chosen roots?

	TReadOff off5p;   // root origin offset, expressed as offset from 5' end
	bool     l2r;     // true -> move in left-to-right direction
	bool     fw;      // true -> work with forward read, false -> revcomp
	size_t   landing; // length of the "landing" in front of the root
	float    pri;     // priority of seed
};

/**
 * Set of flags indicating outgoing edges we've tried from a DescentPos.
 */
struct DescentPosFlags {

	DescentPosFlags() { reset(); }
	
	/**
	 * Set all flags to 1, indicating all outgoing edges are yet to be
	 * explored.
	 */
	void reset() {
		mm_a = mm_c = mm_g = mm_t = rdg_a = rdg_c = rdg_g = rdg_t = rfg = 1;
		reserved = 0;
	}
	
	/**
	 * Return true iff all outgoing edges have already been explored.
	 */
	bool exhausted() const {
		return ((uint16_t*)this)[0] == 0;
	}
	
	/**
	 * Return false iff the specified mismatch has already been explored.
	 */
	bool mmExplore(int c) {
		assert_range(0, 3, c);
		if(c == 0) {
			return mm_a;
		} else if(c == 1) {
			return mm_c;
		} else if(c == 2) {
			return mm_g;
		} else {
			return mm_t;
		}
	}

	/**
	 * Try to explore a mismatch.  Return false iff it has already been
	 * explored.
	 */
	bool mmSet(int c) {
		assert_range(0, 3, c);
		if(c == 0) {
			bool ret = mm_a; mm_a = 0; return ret;
		} else if(c == 1) {
			bool ret = mm_c; mm_c = 0; return ret;
		} else if(c == 2) {
			bool ret = mm_g; mm_g = 0; return ret;
		} else {
			bool ret = mm_t; mm_t = 0; return ret;
		}
	}

	/**
	 * Return false iff specified read gap has already been explored.
	 */
	bool rdgExplore(int c) {
		assert_range(0, 3, c);
		if(c == 0) {
			return rdg_a;
		} else if(c == 1) {
			return rdg_c;
		} else if(c == 2) {
			return rdg_g;
		} else {
			return rdg_t;
		}
	}

	/**
	 * Try to explore a read gap.  Return false iff it has already been
	 * explored.
	 */
	bool rdgSet(int c) {
		assert_range(0, 3, c);
		if(c == 0) {
			bool ret = rdg_a; rdg_a = 0; return ret;
		} else if(c == 1) {
			bool ret = rdg_c; rdg_c = 0; return ret;
		} else if(c == 2) {
			bool ret = rdg_g; rdg_g = 0; return ret;
		} else {
			bool ret = rdg_t; rdg_t = 0; return ret;
		}
	}

	/**
	 * Return false iff the reference gap has already been explored.
	 */
	bool rfgExplore() {
		return rfg;
	}

	/**
	 * Try to explore a reference gap.  Return false iff it has already been
	 * explored.
	 */
	bool rfgSet() {
		bool ret = rfg; rfg = 0; return ret;
	}

	uint16_t mm_a     : 1;
	uint16_t mm_c     : 1;
	uint16_t mm_g     : 1;
	uint16_t mm_t     : 1;

	uint16_t rdg_a    : 1;
	uint16_t rdg_c    : 1;
	uint16_t rdg_g    : 1;
	uint16_t rdg_t    : 1;

	uint16_t rfg      : 1;
	
	uint16_t reserved : 7;
};

/**
 * FM Index state associated with a single position in a descent.  For both the
 * forward and backward indexes, it stores the four SA ranges corresponding to
 * the four nucleotides.
 */
struct DescentPos {

	/**
	 * Reset all tops and bots to 0.
	 */
	void reset() {
		topf[0] = topf[1] = topf[2] = topf[3] = 0;
		botf[0] = botf[1] = botf[2] = botf[3] = 0;
		topb[0] = topb[1] = topb[2] = topb[3] = 0;
		botb[0] = botb[1] = botb[2] = botb[3] = 0;
        c = -1;
		flags.reset();
	}
    
    /**
     * Return true iff DescentPos has been initialized.
     */
    bool inited() const {
        return c >= 0;
    }
	
#ifndef NDEBUG
	/**
	 * Check that DescentPos is internally consistent.
	 */
	bool repOk() const {
		assert_range(0, 3, (int)c);
		return true;
	}
#endif
	
	TIndexOffU       topf[4]; // SA range top indexes in fw index
	TIndexOffU       botf[4]; // SA range bottom indexes (exclusive) in fw index
	TIndexOffU       topb[4]; // SA range top indexes in bw index
	TIndexOffU       botb[4]; // SA range bottom indexes (exclusive) in bw index
    char            c;       // read char that would yield match
	DescentPosFlags flags;   // flags 
};

/**
 * Encapsulates an edge outgoing from a descent.
 */
struct DescentEdge {

	DescentEdge() { reset(); }

	DescentEdge(
		Edit e_,
		TReadOff off5p_,
		DescentPriority pri_,
        size_t posFlag_,
		TReadOff nex_
#ifndef NDEBUG
        ,
        size_t d_,
		TIndexOffU topf_,
		TIndexOffU botf_,
		TIndexOffU topb_,
		TIndexOffU botb_
#endif
        )
	{
		init(e_, off5p_, pri_, posFlag_
#ifndef NDEBUG
        , d_, topf_, botf_, topb_, botb_
#endif
        );
	}

	/**
	 * Return true iff edge is initialized.
	 */
	bool inited() const { return e.inited(); }

	/**
	 * Reset to uninitialized state.
	 */
	void reset() { e.reset(); }
	
	/**
	 * Initialize DescentEdge given 5' offset, nucleotide, and priority.
	 */
	void init(
		Edit e_,
		TReadOff off5p_,
		DescentPriority pri_,
        size_t posFlag_
#ifndef NDEBUG
        ,
        size_t d_,
		TIndexOffU topf_,
		TIndexOffU botf_,
		TIndexOffU topb_,
		TIndexOffU botb_
#endif
        )
	{
		e = e_;
		off5p = off5p_;
		pri = pri_;
        posFlag = posFlag_;
#ifndef NDEBUG
        d = d_;
		topf = topf_;
		botf = botf_;
		topb = topb_;
		botb = botb_;
#endif
	}

    /**
     * Update flags to show this edge as visited.
     */
    void updateFlags(EFactory<DescentPos>& pf) {
        if(inited()) {
            if(e.isReadGap()) {
                assert_neq('-', e.chr);
                pf[posFlag].flags.rdgSet(asc2dna[e.chr]);
            } else if(e.isRefGap()) {
                pf[posFlag].flags.rfgSet();
            } else {
                assert_neq('-', e.chr);
                pf[posFlag].flags.mmSet(asc2dna[e.chr]);
            }
        }
    }
	
	/**
	 * Return true iff this edge has higher priority than the given edge.
	 */
	bool operator<(const DescentEdge& o) const {
        if(inited() && !o.inited()) {
            return true;
        } else if(!inited()) {
            return false;
        }
		return pri < o.pri;
	}

	DescentPriority pri; // priority of the edge
	TReadOff nex;        // # extends possible from this edge
    size_t posFlag;      // depth of DescentPos where flag should be set


#ifndef NDEBUG
    // This can be recreated by looking at the edit, the paren't descent's
    // len_, al5pi_, al5pf_.  I have it here so we can sanity check.
    size_t d;
	TIndexOffU topf, botf, topb, botb;
#endif

	Edit e;
	TReadOff off5p;
};

/**
 * Encapsulates an incomplete summary of the outgoing edges from a descent.  We
 * don't try to store information about all outgoing edges, because doing so
 * will generally be wasteful.  We'll typically only try a handful of them per
 * descent.
 */
class DescentOutgoing {

public:

	/**
	 * Return the best edge and rotate in preparation for next call.
	 */
	DescentEdge rotate() {
		DescentEdge tmp = best1;
        assert(!(best2 < tmp));
		best1 = best2;
        assert(!(best3 < best2));
		best2 = best3;
        assert(!(best4 < best3));
		best3 = best4;
        assert(!(best5 < best4));
		best4 = best5;
		best5.reset();
		return tmp;
	}
	
	/**
	 * Given a potental outgoing edge, place it where it belongs in the running
	 * list of best 5 outgoing edges from this descent.
	 */
	void update(DescentEdge e) {
		if(!best1.inited()) {
			best1 = e;
		} else if(e < best1) {
			best5 = best4;
			best4 = best3;
			best3 = best2;
			best2 = best1;
			best1 = e;
		} else if(!best2.inited()) {
			best2 = e;
		} else if(e < best2) {
			best5 = best4;
			best4 = best3;
			best3 = best2;
			best2 = e;
		} else if(!best3.inited()) {
			best3 = e;
		} else if(e < best3) {
			best5 = best4;
			best4 = best3;
			best3 = e;
		} else if(!best4.inited()) {
			best4 = e;
		} else if(e < best4) {
			best5 = best4;
			best4 = e;
		}  else if(!best5.inited() || e < best5) {
			best5 = e;
		}
	}
	
	/**
	 * Clear all the outgoing edges stored here.
	 */
	void clear() {
		best1.reset();
		best2.reset();
		best3.reset();
		best4.reset();
		best5.reset();
	}
	
	/**
	 * Return true iff there are no outgoing edges currently represented in
	 * this summary.  There may still be outgoing edges, they just haven't
	 * been added to the summary.
	 */
	bool empty() const {
		return !best1.inited();
	}
	
	/**
	 * Return the DescentPriority of the best outgoing edge.
	 */
	DescentPriority bestPri() const {
		assert(!empty());
		return best1.pri;
	}

	DescentEdge best1; // best
	DescentEdge best2; // 2nd-best
	DescentEdge best3; // 3rd-best
	DescentEdge best4; // 4th-best
	DescentEdge best5; // 5th-best
};

class DescentAlignmentSink;

/**
 * Encapsulates a descent through a search tree, along a path of matches.
 * Descents that are part of the same alignment form a chain.  Two aligments
 * adjacent in the chain are connected either by an edit, or by a switch in
 * direction.  Because a descent might have a different direction from the
 * DescentRoot it ultimately came from, it has its own 'l2r' field, which might
 * differ from the root's.
 */
class Descent {

public:

	Descent() { reset(); }

	/**
	 * Initialize a new descent branching from the given descent via the given
	 * edit.  Return false if the Descent has no outgoing edges (and can
     * therefore have its memory freed), true otherwise.
	 */
	bool init(
		const Read& q,                  // query
		TRootId rid,                    // root id
		const Scoring& sc,              // scoring scheme
		TAlScore minsc,                 // minimum score
		TAlScore maxpen,                // maximum penalty
		TReadOff al5pi,                 // offset from 5' of 1st aligned char
		TReadOff al5pf,                 // offset from 5' of last aligned char
		TIndexOffU topf,                 // SA range top in FW index
		TIndexOffU botf,                 // SA range bottom in FW index
		TIndexOffU topb,                 // SA range top in BW index
		TIndexOffU botb,                 // SA range bottom in BW index
		bool l2r,                       // direction this descent will go in
		size_t descid,                  // my ID
		TDescentId parent,              // parent ID
		TScore pen,                     // total penalties so far
		const Edit& e,                  // edit for incoming edge
		const Ebwt& ebwtFw,             // forward index
		const Ebwt& ebwtBw,             // mirror index
		DescentRedundancyChecker& re,   // redundancy checker
		EFactory<Descent>& df,          // Descent factory
		EFactory<DescentPos>& pf,       // DescentPos factory
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
		EHeap<TDescentPair>& heap,      // heap
        DescentAlignmentSink& alsink,   // alignment sink
		DescentMetrics& met,            // metrics
		PerReadMetrics& prm);           // per-read metrics

	/**
	 * Initialize a new descent beginning at the given root.  Return false if
     * the Descent has no outgoing edges (and can therefore have its memory
     * freed), true otherwise.
	 */
	bool init(
        const Read& q,                  // query
        TRootId rid,                    // root id
        const Scoring& sc,              // scoring scheme
		TAlScore minsc,                 // minimum score
		TAlScore maxpen,                // maximum penalty
        size_t descid,                  // id of this Descent
        const Ebwt& ebwtFw,             // forward index
        const Ebwt& ebwtBw,             // mirror index
		DescentRedundancyChecker& re,   // redundancy checker
        EFactory<Descent>& df,          // Descent factory
        EFactory<DescentPos>& pf,       // DescentPos factory
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
        EHeap<TDescentPair>& heap,      // heap
        DescentAlignmentSink& alsink,   // alignment sink
        DescentMetrics& met,            // metrics
		PerReadMetrics& prm);           // per-read metrics
	
	/**
	 * Return true iff this Descent has been initialized.
	 */
	bool inited() const {
		return descid_ != std::numeric_limits<size_t>::max();
	}
	
	/**
	 * Reset to uninitialized state.
	 */
	void reset() {
        lastRecalc_ = true;
		descid_ = std::numeric_limits<size_t>::max();
	}
	
	/**
	 * Return true iff this Descent is a search root.
	 */
	bool root() const {
		return parent_ == std::numeric_limits<TDescentId>::max();
	}
	
	/**
	 * Return the edit.
	 */
	const Edit& edit() const {
		return edit_;
	}
	
	/**
	 * Return id of parent.
	 */
	TDescentId parent() const {
		return parent_;
	}
	
	/**
	 * Take the best outgoing edge and follow it.
	 */
	void followBestOutgoing(
        const Read& q,                  // read
        const Ebwt& ebwtFw,             // forward index
        const Ebwt& ebwtBw,             // mirror index
        const Scoring& sc,              // scoring scheme
		TAlScore minsc,                 // minimum score
		TAlScore maxpen,                // maximum penalty
		DescentRedundancyChecker& re,   // redundancy checker
		EFactory<Descent>& df,          // factory with Descent
		EFactory<DescentPos>& pf,       // factory with DescentPoss
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
        EHeap<TDescentPair>& heap,      // heap of descents
        DescentAlignmentSink& alsink,   // alignment sink
        DescentMetrics& met,            // metrics
		PerReadMetrics& prm);           // per-read metrics
	
	/**
	 * Return true iff no outgoing edges from this descent remain unexplored.
	 */
	bool empty() const { return lastRecalc_ && out_.empty(); }
	
#ifndef NDEBUG
	/**
	 * Return true iff the Descent is internally consistent.
	 */
	bool repOk(const Read *q) const {
		// A non-root can have an uninitialized edit_ if it is from a bounce
		//assert( root() ||  edit_.inited());
		assert(!root() || !edit_.inited());
		assert_eq(botf_ - topf_, botb_ - topb_);
		if(q != NULL) {
			assert_leq(len_, q->length());
		}
		return true;
	}
#endif
	
	size_t al5pi() const { return al5pi_; }
	size_t al5pf() const { return al5pf_; }
	bool l2r() const { return l2r_; }

	/**
	 * Print a stacked representation of this descent and all its parents.  Assumes that
	 */
	void print(
		std::ostream* os,
		const char *prefix,
        const Read& q,
		size_t trimLf,
		size_t trimRg,
		bool fw,
		const EList<Edit>& edits,
		size_t ei,
		size_t en,
		BTDnaString& rf) const;
	
	/**
	 * Collect all the edits
	 */
	void collectEdits(
		EList<Edit>& edits,
		const Edit *e,
		EFactory<Descent>& df)
	{
		// Take just the portion of the read that has aligned up until this
		// point
		size_t nuninited = 0;
		size_t ei = edits.size();
		size_t en = 0;
		if(e != NULL && e->inited()) {
			edits.push_back(*e);
			en++;
		}
		size_t cur = descid_;
		while(cur != std::numeric_limits<TDescentId>::max()) {
			if(!df[cur].edit().inited()) {
				nuninited++;
				assert_leq(nuninited, 2);
			} else {
				edits.push_back(df[cur].edit());
				en++;
			}
			cur = df[cur].parent();
		}
		// Sort just the edits we just added
		edits.sortPortion(ei, en);
	}
	
	TIndexOffU topf() const { return topf_; }
	TIndexOffU botf() const { return botf_; }

protected:

	/**
	 * When the search reaches the edge of the read and needs to "bounce" and
	 * extend in the other direction.
	 */
    bool bounce(
        const Read& q,                  // query string
        TIndexOffU topf,                 // SA range top in fw index
        TIndexOffU botf,                 // SA range bottom in fw index
        TIndexOffU topb,                 // SA range top in bw index
        TIndexOffU botb,                 // SA range bottom in bw index
        const Ebwt& ebwtFw,             // forward index
        const Ebwt& ebwtBw,             // mirror index
        const Scoring& sc,              // scoring scheme
		TAlScore minsc,                 // minimum score
		TAlScore maxpen,                // maximum penalty
		DescentRedundancyChecker& re,   // redundancy checker
		EFactory<Descent>& df,          // factory with Descent
		EFactory<DescentPos>& pf,       // factory with DescentPoss
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
        EHeap<TDescentPair>& heap,      // heap of descents
        DescentAlignmentSink& alsink,   // alignment sink
        DescentMetrics& met,            // metrics
		PerReadMetrics& prm);           // per-read metrics

	/**
	 * Given the forward and backward indexes, and given topf/botf/topb/botb,
	 * get tloc, bloc ready for the next step.
	 */
	void nextLocsBi(
		const Ebwt& ebwtFw, // forward index
		const Ebwt& ebwtBw, // mirror index
		SideLocus& tloc,    // top locus
		SideLocus& bloc,    // bot locus
		TIndexOffU topf,      // top in BWT
		TIndexOffU botf,      // bot in BWT
		TIndexOffU topb,      // top in BWT'
		TIndexOffU botb);     // bot in BWT'

	/**
	 * Advance this descent by following read matches as far as possible.
	 */
    bool followMatches(
        const Read& q,     // query string
		const Scoring& sc,         // scoring scheme
        const Ebwt& ebwtFw,        // forward index
        const Ebwt& ebwtBw,        // mirror index
		DescentRedundancyChecker& re, // redundancy checker
        EFactory<Descent>& df,     // Descent factory
        EFactory<DescentPos>& pf,  // DescentPos factory
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
        EHeap<TDescentPair>& heap, // heap
        DescentAlignmentSink& alsink, // alignment sink
        DescentMetrics& met,       // metrics
		PerReadMetrics& prm,       // per-read metrics
        bool& branches,            // out: true -> there are > 0 ways to branch
        bool& hitEnd,              // out: true -> hit read end with non-empty range
        bool& done,                // out: true -> we made a full alignment
        TReadOff& off5p_i,         // out: initial 5' offset
        TIndexOffU& topf_bounce,    // out: top of SA range for fw idx for bounce
        TIndexOffU& botf_bounce,    // out: bot of SA range for fw idx for bounce
        TIndexOffU& topb_bounce,    // out: top of SA range for bw idx for bounce
        TIndexOffU& botb_bounce);   // out: bot of SA range for bw idx for bounce

	/**
	 * Recalculate our summary of the outgoing edges from this descent.  When
	 * deciding what outgoing edges are legal, we abide by constraints.
	 * Typically, they limit the total of the penalties accumulated so far, as
	 * a function of distance from the search root.  E.g. a constraint might
	 * disallow any gaps or mismatches within 20 ply of the search root, then
	 * allow 1 mismatch within 30 ply, then allow up to 1 mismatch or 1 gap
	 * within 40 ply, etc.
	 */
	size_t recalcOutgoing(
		const Read& q,                   // query string
		const Scoring& sc,               // scoring scheme
		TAlScore minsc,                  // minimum score
		TAlScore maxpen,                 // maximum penalty
		DescentRedundancyChecker& re,    // redundancy checker
		EFactory<DescentPos>& pf,        // factory with DescentPoss
        const EList<DescentRoot>& rs,    // roots
        const EList<DescentConfig>& cs,  // configs
		PerReadMetrics& prm);            // per-read metrics

    TRootId         rid_;         // root id

	TReadOff        al5pi_;       // lo offset from 5' end of aligned read char
	TReadOff        al5pf_;       // hi offset from 5' end of aligned read char
	bool            l2r_;         // left-to-right?
	int             gapadd_;      // net ref characters additional
    TReadOff        off5p_i_;     // offset we started out at for this descent

	TIndexOffU       topf_, botf_; // incoming SA range w/r/t forward index
	TIndexOffU       topb_, botb_; // incoming SA range w/r/t forward index

	size_t          descid_;      // ID of this descent
	TDescentId      parent_;      // ID of parent descent
	TScore          pen_;         // total penalties accumulated so far
	size_t          posid_;       // ID of 1st elt of the DescentPos factory w/
	                              // descent pos info for this descent
	size_t          len_;         // length of stretch of matches
	DescentOutgoing out_;         // summary of outgoing edges
	Edit            edit_;        // edit joining this descent with parent
	bool            lastRecalc_;  // set by recalcOutgoing if out edges empty
};

/**
 * An alignment result from a Descent.
 */
struct DescentAlignment {

	DescentAlignment() { reset(); }

	/**
	 * Reset DescentAlignment to be uninitialized.
	 */
	void reset() {
		topf = botf = 0;
		pen = 0;
		fw = false;
		ei = en = 0;
	}

	/**
	 * Initialize this DescentAlignment.
	 */
	void init(
		TScore pen_,
		bool fw_,
		TIndexOffU topf_,
		TIndexOffU botf_,
		size_t ei_,
		size_t en_)
	{
		assert_gt(botf_, topf_);
		pen = pen_;
		fw = fw_;
		topf = topf_;
		botf = botf_;
		ei = ei_;
		en = en_;
	}
	
	/**
	 * Return true iff DescentAlignment is initialized.
	 */
	bool inited() const {
		return botf > topf;
	}
	
	/**
	 * Return true iff the alignment is perfect (has no edits)
	 */
	bool perfect() const {
		return pen == 0;
	}
	
	/**
	 * Return the number of elements in this range.
	 */
	size_t size() const {
		return botf - topf;
	}

	TScore pen; // penalty
	
	bool fw; // forward or revcomp aligned?

	TIndexOffU topf; // top in forward index
	TIndexOffU botf; // bot in forward index

	size_t ei; // First edit in DescentAlignmentSink::edits_ involved in aln
	size_t en; // # edits in DescentAlignmentSink::edits_ involved in aln
};

/**
 * A partial alignment result from a Descent where the reference offset has
 * been resolved.
 */
struct DescentPartialResolvedAlignment {

	DescentPartialResolvedAlignment() { reset(); }

	/**
	 * Reset DescentAlignment to be uninitialized.
	 */
	void reset() {
		topf = botf = 0;
		pen = 0;
		fw = false;
		ei = en = 0;
		refcoord.reset();
	}

	/**
	 * Initialize this DescentAlignment.
	 */
	void init(
		TScore pen_,
		bool fw_,
		TIndexOffU topf_,
		TIndexOffU botf_,
		size_t ei_,
		size_t en_,
		const Coord& refcoord_)
	{
		assert_gt(botf_, topf_);
		pen = pen_;
		fw = fw_;
		topf = topf_;
		botf = botf_;
		ei = ei_;
		en = en_;
		refcoord = refcoord_;
	}
	
	/**
	 * Return true iff DescentAlignment is initialized.
	 */
	bool inited() const {
		return botf > topf;
	}
	
	/**
	 * Return the number of elements in this range.
	 */
	size_t size() const {
		return botf - topf;
	}

	TScore pen;     // score
	
	bool fw;        // forward or revcomp aligned?

	TIndexOffU topf; // top in forward index
	TIndexOffU botf; // bot in forward index

	size_t ei;      // First edit in DescentPartialResolvedAlignmentSink::edits_ involved in aln
	size_t en;      // # edits in DescentPartialResolvedAlignmentSink::edits_ involved in aln
	
	Coord refcoord; // reference coord of leftmost ref char involved
};

/**
 * Class that accepts alignments found during descent and maintains the state
 * required to dispense them to consumers in an appropriate order.
 *
 * As for order in which they are dispensed, in order to maintain uniform
 * distribution over equal-scoring alignments, a good policy may be not to
 * dispense alignments at a given score stratum until *all* alignments at that
 * stratum have been accumulated (i.e. until our best-first search has moved on
 * to a worse stratum).  This also has the advantage that, for each alignment,
 * we can also report the number of other alignments in that cost stratum.
 *
 * A lazier alternative is to assume that the order in which alignments in a
 * given stratum arrive is already pseudo-random, which frees us from having to
 * wait until the entire stratum has been explored.  But there is reason to
 * think that this order is not truly pseudo-random, since our root placement
 * and root priorities will tend to first lead us to alignments with certain
 * patterns of edits.
 */
class DescentAlignmentSink {

public:

    /**
     * If this is the final descent in a complete end-to-end alignment, report
     * the alignment.
     */
    bool reportAlignment(
        const Read& q,           // query string
		const Ebwt& ebwtFw,              // forward index
		const Ebwt& ebwtBw,              // mirror index
		TIndexOffU topf,                  // SA range top in forward index
		TIndexOffU botf,                  // SA range bottom in forward index
		TIndexOffU topb,                  // SA range top in backward index
		TIndexOffU botb,                  // SA range bottom in backward index
        TDescentId id,                   // id of leaf Descent
		TRootId rid,                     // id of search root
        const Edit& e,                   // final edit, if needed
        TScore pen,                      // total penalty
        EFactory<Descent>& df,           // factory with Descent
        EFactory<DescentPos>& pf,        // factory with DescentPoss
        const EList<DescentRoot>& rs,    // roots
        const EList<DescentConfig>& cs); // configs
    
    /**
     * Reset to uninitialized state.
     */
    void reset() {
		edits_.clear();
		als_.clear();
		lhs_.clear();
		rhs_.clear();
		nelt_ = 0;
		bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
    }

	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return edits_.totalSizeBytes() +
		       als_.totalSizeBytes() +
			   lhs_.totalSizeBytes() +
			   rhs_.totalSizeBytes() +
			   sizeof(size_t);
	}

	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return edits_.totalCapacityBytes() +
		       als_.totalCapacityBytes() +
			   lhs_.totalCapacityBytes() +
			   rhs_.totalCapacityBytes() +
			   sizeof(size_t);
	}
	
	/**
	 * Return the number of SA ranges involved in hits.
	 */
	size_t nrange() const {
		return als_.size();
	}

	/**
	 * Return the number of SA elements involved in hits.
	 */
	size_t nelt() const {
		return nelt_;
	}
	
	/**
	 * The caller provides 'i', which is an offset of a particular element in
	 * one of the SA ranges in the current stratum.  This function returns, in
	 * 'al' and 'off', information about the element in terms of the range it's
	 * part of and its offset into that range.
	 */
	void elt(size_t i, DescentAlignment& al, size_t& ri, size_t& off) const {
		assert_lt(i, nelt());
		for(size_t j = 0; j < als_.size(); j++) {
			if(i < als_[j].size()) {
				al = als_[j];
				ri = j;
				off = i;
				return;
			}
			i -= als_[j].size();
		}
		assert(false);
	}
	
	/**
	 * Get a particular alignment.
	 */
	const DescentAlignment& operator[](size_t i) const {
		return als_[i];
	}

	/**
	 * Return true iff (a) we found an alignment since the sink was initialized
	 * or since the last time advanceStratum() was called, and (b) the penalty
	 * associated with the current-best task on the heap ('best') is worse
	 * (higher) than the penalty associated with the alignments found most
	 * recently (worstPen_).
	 */
	bool stratumDone(TAlScore bestPen) const {
		if(nelt_ > 0 && bestPen > worstPen_) {
			return true;
		}
		return false;
	}
	
	/**
	 * The alignment consumer calls this to indicate that they are done with
	 * all the alignments in the current best non-empty stratum.  We can
	 * therefore mark all those alignments as "reported" and start collecting
	 * results for the next stratum.
	 */
	void advanceStratum() {
		assert_gt(nelt_, 0);
		edits_.clear();
		als_.clear();
		// Don't reset lhs_ or rhs_
		nelt_ = 0;
		bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
	}
	
#ifndef NDEBUG
	/**
	 * Check that alignment sink is internally consistent.
	 */
	bool repOk() const {
		assert_geq(nelt_, als_.size());
		for(size_t i = 1; i < als_.size(); i++) {
			assert_geq(als_[i].pen, als_[i-1].pen);
		}
		assert(bestPen_ == std::numeric_limits<TAlScore>::max() || worstPen_ >= bestPen_);
		return true;
	}
#endif
	
	TAlScore bestPenalty() const { return bestPen_; }
	TAlScore worstPenalty() const { return worstPen_; }

	size_t editsSize() const { return edits_.size(); }
	size_t alsSize() const { return als_.size(); }
	size_t lhsSize() const { return lhs_.size(); }
	size_t rhsSize() const { return rhs_.size(); }
	
	const EList<Edit>& edits() const { return edits_; }

protected:

	EList<Edit> edits_;
	EList<DescentAlignment> als_;
	ESet<Triple<TIndexOffU, TIndexOffU, size_t> > lhs_;
	ESet<Triple<TIndexOffU, TIndexOffU, size_t> > rhs_;
	size_t nelt_;
	TAlScore bestPen_;  // best (smallest) penalty among as-yet-unreported alns
	TAlScore worstPen_; // worst (greatest) penalty among as-yet-unreported alns
#ifndef NDEBUG
	BTDnaString tmprfdnastr_;
#endif

};

/**
 * Class that aggregates partial alignments taken from a snapshot of the
 * DescentDriver heap.
 */
class DescentPartialResolvedAlignmentSink {

public:
   
    /**
     * Reset to uninitialized state.
     */
    void reset() {
		edits_.clear();
		als_.clear();
    }

	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return edits_.totalSizeBytes() +
		       als_.totalSizeBytes() +
			   sizeof(size_t);
	}

	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return edits_.totalCapacityBytes() +
		       als_.totalCapacityBytes() +
			   sizeof(size_t);
	}
	
	/**
	 * Get a particular alignment.
	 */
	const DescentPartialResolvedAlignment& operator[](size_t i) const {
		return als_[i];
	}
	
	size_t editsSize() const { return edits_.size(); }
	size_t alsSize() const { return als_.size(); }
	
	const EList<Edit>& edits() const { return edits_; }

protected:

	EList<Edit> edits_;
	EList<DescentPartialResolvedAlignment> als_;
};

/**
 * Abstract parent for classes that select descent roots and descent
 * configurations given information about the read.
 */
class DescentRootSelector {

public:

	virtual ~DescentRootSelector() { }

	virtual void select(
		const Read& q,          // read that we're selecting roots for
		const Read* qo,         // opposite mate, if applicable
		bool nofw,              // don't add roots for fw read
		bool norc,              // don't add roots for rc read
		EList<DescentConfig>& confs,    // put DescentConfigs here
		EList<DescentRoot>& roots) = 0; // put DescentRoot here
};

/**
 * Encapsulates a set of conditions governing when the DescentDriver should
 * stop.
 */
struct DescentStoppingConditions {

	DescentStoppingConditions() { reset(); }

	DescentStoppingConditions(
		size_t totsz_,
		size_t nfound_,
		bool stra_,
		size_t nbwop_)
	{
		init(totsz_, nfound_, stra_, nbwop_);
	}
	
	/**
	 * Reset to uninitialized state.
	 */
	void reset() {
		totsz = nfound = nbwop = std::numeric_limits<size_t>::max();
		stra = false;
		assert(!inited());
	}

	/**
	 * Initialize this DescentStoppingConditions.
	 */
	void init(
		size_t totsz_,
		size_t nfound_,
		bool stra_,
		size_t nbwop_)
	{
		totsz = totsz_;
		nfound = nfound_;
		stra = stra_;
		nbwop = nbwop_;
		assert(inited());
	}
	
	/**
	 * Return true iff this instance is initialized.
	 */
	bool inited() const {
		return totsz != std::numeric_limits<size_t>::max();
	}

	size_t totsz;  // total size of all the expandable data structures in bytes
	size_t nfound; // # alignments found
	bool stra;     // stop after each non-empty stratum
	size_t nbwop;  // # Burrows-Wheeler (rank) operations performed
};

enum {
	DESCENT_DRIVER_ALN = 1,
	DESCENT_DRIVER_STRATA = 2,
	DESCENT_DRIVER_MEM = 4,
	DESCENT_DRIVER_BWOPS = 8,
	DESCENT_DRIVER_DONE = 16
};

/**
 * Class responsible for advancing all the descents.  The initial descents may
 * emanate from several different locations in the read.  Note that descents
 * may become redundant with each other, and should then be eliminated.
 */
class DescentDriver {
public:

	DescentDriver(bool veryVerbose = false) :
		veryVerbose_(veryVerbose)
	{
		reset();
	}
	
	/**
	 * Initialize driver with respect to a new read.  If a DescentRootSelector
	 * is specified, then it is used to obtain roots as well.
	 */
	void initRead(
		const Read& q,
		bool nofw,
		bool norc,
		TAlScore minsc,
		TAlScore maxpen,
		const Read* qmate = NULL,
		DescentRootSelector *sel = NULL)
	{
		reset();
		q_ = q;           // copy the read itself
		minsc_ = minsc;   // minimum score
		maxpen_ = maxpen; // maximum penalty
		if(sel != NULL) {
			sel->select(  // Select search roots
				q_,       // in: read
				qmate,    // in: opposite mate, if paired
				nofw,     // in: true -> don't put roots on fw read
				norc,     // in: true -> don't put roots on rc read
				confs_,   // out: search configs for each root
				roots_);  // out: roots
			//printRoots(std::cerr);
		}
		re_.init(q.length()); // initialize redundancy checker
	}
	
	/**
	 * Add a new search root, which might (a) prefer to move in a left-to-right
	 * direction, and might (b) be with respect to the read or its reverse
	 * complement.
	 */
	void addRoot(
        const DescentConfig& conf,
        TReadOff off,
        bool l2r,
        bool fw,
		size_t landing,
        float pri)
    {
        confs_.push_back(conf);
		assert_lt(off, q_.length());
		if(l2r && off == q_.length()-1) {
			l2r = !l2r;
		} else if(!l2r && off == 0) {
			l2r = !l2r;
		}
		roots_.push_back(DescentRoot(off, l2r, fw, landing, q_.length(), pri));
	}
	
	/**
	 * Clear out the DescentRoots currently configured.
	 */
	void clearRoots() {
		confs_.clear();
		roots_.clear();
	}
	
	/**
	 * Print ASCII picture of where we put the roots.
	 */
	void printRoots(std::ostream& os) {
		std::ostringstream fwstr, rcstr;
		fwstr << q_.patFw << std::endl << q_.qual << std::endl;
		rcstr << q_.patRc << std::endl << q_.qualRev << std::endl;
		for(size_t i = 0; i < roots_.size(); i++) {
			if(roots_[i].fw) {
				for(size_t j = 0; j < roots_[i].off5p; j++) {
					fwstr << " ";
				}
				fwstr << (roots_[i].l2r ? ">" : "<");
				fwstr << " " << i << ":";
				fwstr << roots_[i].pri;
				fwstr << "\n";
			} else {
				size_t off = q_.length() - roots_[i].off5p - 1;
				for(size_t j = 0; j < off; j++) {
					rcstr << " ";
				}
				rcstr << (roots_[i].l2r ? ">" : "<");
				rcstr << " " << i << ":";
				rcstr << roots_[i].pri;
				rcstr << "\n";
			}
		}
		os << fwstr.str() << rcstr.str();
	}
	
	/**
	 * Clear the Descent driver so that we're ready to re-start seed alignment
	 * for the current read.
	 */
	void resetRead() {
		df_.clear();     // clear Descents
		assert_leq(df_.totalSizeBytes(), 100);
		pf_.clear();     // clear DescentPoss
		assert_leq(pf_.totalSizeBytes(), 100);
		heap_.clear();   // clear Heap
		assert_leq(heap_.totalSizeBytes(), 100);
		roots_.clear();  // clear roots
		assert_leq(roots_.totalSizeBytes(), 100);
		confs_.clear();  // clear confs
		assert_leq(confs_.totalSizeBytes(), 100);
        alsink_.reset(); // clear alignment sink
		assert_leq(alsink_.totalSizeBytes(), 100);
		re_.reset();
		assert_leq(re_.totalSizeBytes(), 100);
		rootsInited_ = 0; // haven't yet created initial descents
		curPen_ = 0;      //
	}
	
	/**
	 * Clear the Descent driver so that we're ready to re-start seed alignment
	 * for the current read.
	 */
	void reset() {
		resetRead();
	}

	/**
	 * Perform seed alignment.
	 */
	void go(
        const Scoring& sc,    // scoring scheme
		const Ebwt& ebwtFw,   // forward index
		const Ebwt& ebwtBw,   // mirror index
        DescentMetrics& met,  // metrics
		PerReadMetrics& prm); // per-read metrics

	/**
	 * Perform seed alignment until some stopping condition is satisfied.
	 */
	int advance(
		const DescentStoppingConditions& stopc, // stopping conditions
        const Scoring& sc,    // scoring scheme
		const Ebwt& ebwtFw,   // forward index
		const Ebwt& ebwtBw,   // mirror index
        DescentMetrics& met,  // metrics
		PerReadMetrics& prm); // per-read metrics

#ifndef NDEBUG
	/**
	 * Return true iff this DescentDriver is well formed.  Throw an assertion
	 * otherwise.
	 */
	bool repOk() const {
		return true;
	}
#endif

	/**
	 * Return the number of end-to-end alignments reported.
	 */
	size_t numAlignments() const {
		return alsink_.nelt();
	}
	
	/**
	 * Return the associated DescentAlignmentSink object.
	 */
	const DescentAlignmentSink& sink() const {
		return alsink_;
	}

	/**
	 * Return the associated DescentAlignmentSink object.
	 */
	DescentAlignmentSink& sink() {
		return alsink_;
	}
	
	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return df_.totalSizeBytes() +
		       pf_.totalSizeBytes() +
			   heap_.totalSizeBytes() +
			   roots_.totalSizeBytes() +
			   confs_.totalSizeBytes() +
		       alsink_.totalSizeBytes() +
			   re_.totalSizeBytes();
	}

	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return df_.totalCapacityBytes() +
		       pf_.totalCapacityBytes() +
			   heap_.totalCapacityBytes() +
			   roots_.totalCapacityBytes() +
			   confs_.totalCapacityBytes() +
		       alsink_.totalCapacityBytes() +
			   re_.totalCapacityBytes();
	}
	
	/**
	 * Return a const ref to the query.
	 */
	const Read& query() const {
		return q_;
	}
	
	/**
	 * Return the minimum score that must be achieved by an alignment in order
	 * for it to be considered "valid".
	 */
	TAlScore minScore() const {
		return minsc_;
	}
	
	const EList<DescentRoot>& roots() { return roots_; }
	
	/**
	 * Called to pause the index-assisted search, and collect a set of partial
	 * alignments to try using dynamic programming.
	 *
	 * The space explored so far is represented by the prioritized collection
	 * of Descents in the heap.  Each Descent has one or more outgoing edges.
	 * Each outgoing edge is a set of >=1 partial alignments we might try.
	 */
	void nextPartial() {
	}

protected:

	Read                 q_;      // query nucleotide and quality strings
	TAlScore             minsc_;  // minimum score
	TAlScore             maxpen_; // maximum penalty
	EFactory<Descent>    df_;     // factory holding all the Descents, which
	                              // must be referred to by ID
	EFactory<DescentPos> pf_;     // factory holding all the DescentPoss, which
	                              // must be referred to by ID
	EList<DescentRoot>   roots_;  // search roots
    EList<DescentConfig> confs_;  // configuration params for each root
	size_t rootsInited_;          // # initial Descents already created
	EHeap<TDescentPair>  heap_;   // priority queue of Descents
    DescentAlignmentSink alsink_; // alignment sink
	DescentRedundancyChecker re_; // redundancy checker
	TAlScore             curPen_; // current penalty
	bool veryVerbose_;            // print lots of partial alignments
	
	EList<Edit> tmpedit_;
	BTDnaString tmprfdnastr_;
};

/**
 * Selects alignments to report from a complete non-empty stratum of
 * alignments stored in the DescentAlignmentSink.
 */
class DescentAlignmentSelector {

public:

	DescentAlignmentSelector() : gwstate_(GW_CAT) { reset(); }

	/**
	 * Initialize a new selector w/r/t a DescentAlignmentSink holding a
	 * non-empty alignment stratum.
	 */
	void init(
		const Read& q,
		const DescentAlignmentSink& sink,
		const Ebwt& ebwtFw,         // forward Bowtie index for walking left
		const BitPairReference& ref,// bitpair-encoded reference
		RandomSource& rnd,          // pseudo-random generator for sampling rows
		WalkMetrics& met)
	{
		// We're going to sample from space of *alignments*, not ranges.  So
		// when we extract a sample, we'll have to do a little extra work to
		// convert it to a <range, offset> coordinate.
		rnd_.init(
			sink.nelt(), // # elements to choose from
			true);       // without replacement
		offs_.resize(sink.nelt());
		offs_.fill(std::numeric_limits<TIndexOffU>::max());
		sas_.resize(sink.nrange());
		gws_.resize(sink.nrange());
		size_t ei = 0;
		for(size_t i = 0; i < sas_.size(); i++) {
			size_t en = sink[i].botf - sink[i].topf;
			sas_[i].init(sink[i].topf, EListSlice<TIndexOffU, 16>(offs_, ei, en));
			gws_[i].init(ebwtFw, ref, sas_[i], rnd, met);
			ei += en;
		}
	}
	
	/**
	 * Reset the selector.
	 */
	void reset() {
		rnd_.reset();
	}
	
	/**
	 * Return true iff the selector is currently initialized.
	 */
	bool inited() const {
		return rnd_.size() > 0;
	}
	
	/**
	 * Get next alignment and convert it to an AlnRes.
	 */
	bool next(
		const DescentDriver& dr,
		const Ebwt& ebwtFw,          // forward Bowtie index for walking left
		const BitPairReference& ref, // bitpair-encoded reference
		RandomSource& rnd,
		AlnRes& rs,
		WalkMetrics& met,
		PerReadMetrics& prm)
	{
		// Sample one alignment randomly from pool of remaining alignments
		size_t ri = (size_t)rnd_.next(rnd);
		size_t off = 0;
		DescentAlignment al;
		size_t rangei = 0;
		// Convert random alignment index into a <range, offset> coordinate
		dr.sink().elt(ri, al, rangei, off);
		assert_lt(off, al.size());
		Coord refcoord;
		WalkResult wr;
		TIndexOffU tidx = 0, toff = 0, tlen = 0;
		gws_[rangei].advanceElement(
			(TIndexOffU)off,
			ebwtFw,       // forward Bowtie index for walking left
			ref,          // bitpair-encoded reference
			sas_[rangei], // SA range with offsets
			gwstate_,     // GroupWalk state; scratch space
			wr,           // put the result here
			met,          // metrics
			prm);         // per-read metrics
		assert_neq(OFF_MASK, wr.toff);
		bool straddled = false;
		ebwtFw.joinedToTextOff(
			wr.elt.len,
			wr.toff,
			tidx,
			toff,
			tlen,
			true,        // reject straddlers?
			straddled);  // straddled?
		if(tidx == OFF_MASK) {
			// The seed hit straddled a reference boundary so the seed
			// hit isn't valid
			return false;
		}
		// Coordinate of the seed hit w/r/t the pasted reference string
		refcoord.init(tidx, (int64_t)toff, dr.sink()[rangei].fw);
		const EList<Edit>& edits = dr.sink().edits();
		size_t ns = 0, ngap = 0, nrefn = 0;
		for(size_t i = al.ei; i < al.ei + al.en; i++) {
			if(edits[i].qchr == 'N' || edits[i].chr == 'N') ns++;
			if(edits[i].chr == 'N') nrefn++;
			if(edits[i].isGap()) ngap++;
		}
		AlnScore asc(
			-dr.sink().bestPenalty(),  // numeric score
			dr.query().length() - edits.size(),
			(int)edits.size(),         // # edits
			ns,                        // # Ns
			ngap);                     // # gaps
		rs.init(
			dr.query().length(),       // # chars after hard trimming
			asc,                       // alignment score
			&dr.sink().edits(),        // nucleotide edits array
			al.ei,                     // nucleotide edits first pos
			al.en,                     // nucleotide edits last pos
			NULL,                      // ambig base array
			0,                         // ambig base first pos
			0,                         // ambig base last pos
			refcoord,                  // coord of leftmost aligned char in ref
			tlen,                      // length of reference aligned to
			-1,                        // # seed mms allowed
			-1,                        // seed length
			-1,                        // seed interval
			dr.minScore(),             // minimum score for valid alignment
			false,                     // soft pre-trimming?
			0,                         // 5p pre-trimming
			0,                         // 3p pre-trimming
			false,                     // soft trimming?
			0,                         // 5p trimming
			0);                        // 3p trimming
		rs.setRefNs(nrefn);
		return true;
	}
	
	/**
	 * Return true iff all elements have been reported.
	 */
	bool done() const {
		return rnd_.done();
	}

	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return rnd_.totalSizeBytes() +
		       offs_.totalSizeBytes() +
			   sas_.totalSizeBytes() +
			   gws_.totalSizeBytes();
	}

	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return rnd_.totalCapacityBytes() +
		       offs_.totalCapacityBytes() +
			   sas_.totalCapacityBytes() +
			   gws_.totalCapacityBytes();
	}
	
protected:

	Random1toN rnd_;
	EList<TIndexOffU, 16> offs_;
	EList<SARangeWithOffs<EListSlice<TIndexOffU, 16> > > sas_;
	EList<GroupWalk2S<EListSlice<TIndexOffU, 16>, 16> > gws_;
	GroupWalkState gwstate_;
};

/**
 * Selects and prioritizes partial alignments from the heap of the
 * DescentDriver.  We assume that the heap is no longer changing (i.e. that the
 * DescentDriver is done).  Usually, the user will then attempt to extend the
 * partial alignments into full alignments.  This can happen incrementally;
 * that is, the user might ask for the partial alignments one "batch" at a
 * time, and the selector will only do as much work is necessary to supply each
 * requesteded batch.
 *
 * The actual work done here includes: (a) scanning the heap for high-priority
 * partial alignments, (b) setting up the rnd_, offs_, sas_, gws_, and gwstate_
 * fields and resolving offsets of partial alignments, (c) packaging and
 * delivering batches of results to the caller.
 *
 * How to prioritize partial alignments?  One idea is to use the same
 * penalty-based prioritization used in the heap.  This has pros: (a) we can
 * visit the partial alignments in best-to-worst order w/r/t penalty, (b) the
 * heap is already prioritized this way, so it's easier for us to compile
 * high-priority partial alignments.  But the con is that it doesn't take depth
 * into account, which could mean that we're extending a lot of very short
 * partial alignments first.
 *
 * Some ranges will be large and others will be small.  It's a good idea to try
 * all the elements in the small ranges, but it's also good not to ignore the
 * large ranges.  One idea is to keep all the large ranges in one category and
 * all the small ranges in another and alternate between the two.
 */
class DescentPartialAlignmentSelector {

public:

	// Ranges bigger than this are considered "big" and put in their own
	// category.
	static const size_t BIG_RANGE = 5;

	// Number of ranges to pull out of the heap in one go
	static const size_t NRANGE_AT_A_TIME = 3;

	DescentPartialAlignmentSelector() : gwstate_(GW_CAT) { reset(); }

	/**
	 * Initialize a new selector w/r/t a read, index and heap of partial
	 * alignments.
	 */
	void init(
		const Read& q,                   // read
		const EHeap<TDescentPair>& heap, // the heap w/ the partial alns
        EFactory<Descent>& df,           // Descent factory
        EFactory<DescentPos>& pf,        // DescentPos factory
		TAlScore depthBonus,             // use depth when prioritizing
		size_t nbatch,                   // # of alignments in a batch
		const Ebwt& ebwtFw,              // forward Bowtie index for walk-left
		const BitPairReference& ref,     // bitpair-encoded reference
		RandomSource& rnd,               // pseudo-randoms for sampling rows
		WalkMetrics& met)                // metrics re: offset resolution
	{
		// Make our internal heap
		if(depthBonus > 0) {
			heap_.clear();
			for(size_t i = 0; i < heap.size(); i++) {
				TDescentPair p = heap[i];
				p.first.pen += depthBonus * p.first.depth;
				heap_.insert(p);
			}
		} else heap_ = heap;
		assert(!heap_.empty());
		nextRanges(df, pf, ebwtFw, ref, rnd, met);
		assert(!rangeExhausted());
	}
	
	/**
	 * Return true iff there are no more partial alignments to extend.
	 */
	bool empty() const {
		return heap_.empty();
	}
	
	/**
	 * Reset the selector.
	 */
	void reset() {
		heap_.clear();
		offs_.clear();
		sas_.clear();
		gws_.clear();
	}
	
	/**
	 * Return true iff the selector is currently initialized.
	 */
	bool inited() const {
		return !heap_.empty();
	}
	
	/**
	 * Get next partial alignment and convert it to an AlnRes.
	 */
	bool nextPartial(
		const DescentDriver& dr,
		const Ebwt& ebwtFw,          // forward Bowtie index for walking left
		const BitPairReference& ref, // bitpair-encoded reference
		RandomSource& rnd,
		AlnRes& rs,
		WalkMetrics& met,
		PerReadMetrics& prm)
	{
		// Sample one alignment randomly from pool of remaining alignments
		size_t ri = (size_t)rnd_.next(rnd);
		size_t off = 0;
		DescentAlignment al;
		size_t rangei = 0;
		// Convert random alignment index into a <range, offset> coordinate
		dr.sink().elt(ri, al, rangei, off);
		assert_lt(off, al.size());
		Coord refcoord;
		WalkResult wr;
		TIndexOffU tidx = 0, toff = 0, tlen = 0;
		gws_[rangei].advanceElement(
			(TIndexOffU)off,
			ebwtFw,       // forward Bowtie index for walking left
			ref,          // bitpair-encoded reference
			sas_[rangei], // SA range with offsets
			gwstate_,     // GroupWalk state; scratch space
			wr,           // put the result here
			met,          // metrics
			prm);         // per-read metrics
		assert_neq(OFF_MASK, wr.toff);
		bool straddled = false;
		ebwtFw.joinedToTextOff(
			wr.elt.len,
			wr.toff,
			tidx,
			toff,
			tlen,
			true,        // reject straddlers?
			straddled);  // straddled?
		if(tidx == OFF_MASK) {
			// The seed hit straddled a reference boundary so the seed
			// hit isn't valid
			return false;
		}
		refcoord.init(tidx, (int64_t)toff, dr.sink()[rangei].fw);
		const EList<Edit>& edits = dr.sink().edits();
		size_t ns = 0, ngap = 0, nrefn = 0;
		for(size_t i = al.ei; i < al.ei + al.en; i++) {
			if(edits[i].qchr == 'N' || edits[i].chr == 'N') ns++;
			if(edits[i].chr == 'N') nrefn++;
			if(edits[i].isGap()) ngap++;
		}
		return true;
	}
	
	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return heap_.totalSizeBytes() +
		       rnd_.totalSizeBytes() +
		       offs_.totalSizeBytes() +
			   sas_.totalSizeBytes() +
			   gws_.totalSizeBytes();
	}
	
	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return heap_.totalCapacityBytes() +
		       rnd_.totalCapacityBytes() +
		       offs_.totalCapacityBytes() +
			   sas_.totalCapacityBytes() +
			   gws_.totalCapacityBytes();
	}
	
protected:
	
	/**
	 * Return true iff all elements in the current range have been extended.
	 */
	bool rangeExhausted() const {
		return rnd_.left() == 0;
	}
	
	/**
	 *
	 */
	void nextRanges(
        EFactory<Descent>& df,           // Descent factory
        EFactory<DescentPos>& pf,        // DescentPos factory
		const Ebwt& ebwtFw,              // forward Bowtie index for walk-left
		const BitPairReference& ref,     // bitpair-encoded reference
		RandomSource& rnd,               // pseudo-randoms for sampling rows
		WalkMetrics& met)                // metrics re: offset resolution
	{
		// Pop off the topmost
		assert(!heap_.empty());
		TDescentPair p = heap_.pop();
		TIndexOffU topf = df[p.second].topf(), botf = df[p.second].botf();
		assert_gt(botf, topf);
		offs_.resize(botf - topf);
		offs_.fill(std::numeric_limits<TIndexOffU>::max());
		rnd_.init(botf - topf, true); // without replacement
		sas_.resize(1);
		gws_.resize(1);
		sas_[0].init(topf, EListSlice<TIndexOffU, 16>(offs_, 0, botf - topf));
		gws_[0].init(ebwtFw, ref, sas_[0], rnd, met);
	}
	
	DescentPartialResolvedAlignmentSink palsink_;

	// This class's working heap.  This might simply be a copy of the original
	// heap, or it might be re-prioritized in some way.
	EHeap<TDescentPair> heap_;

	Random1toN rnd_;
	EList<TIndexOffU, 16> offs_;
	EList<SARangeWithOffs<EListSlice<TIndexOffU, 16> > > sas_;
	EList<GroupWalk2S<EListSlice<TIndexOffU, 16>, 16> > gws_;
	GroupWalkState gwstate_;
};

#endif